Journal of Structural Biology 150 (2005) 50–57 www.elsevier.com/locate/yjsbi

Trimeric structure of OprN and OprM eZux proteins from Pseudomonas aeruginosa, by 2D electron crystallography Olivier Lambert a,1, Houssain Benabdelhak b,1, Mohamed Chami a,2, Ludovic Jouan a, Emilie Nouaille a, Arnaud Ducruix b, Alain Brisson a,¤ b

a IECB, UMR-CNRS 5471, Université Bordeaux1, 2 rue Robert Escarpit, F-33607 Pessac, France Laboratoire de Cristallographie et RMN Biologiques, UMR 8015 CNRS, Faculté de Pharmacie Paris 5, Université René Descartes, 4 avenue de l’observatoire, 75270 Paris Cedex 06, France

Received 15 November 2004, and in revised form 24 December 2004 Available online 2 February 2005

Abstract OprM and OprN belong to the outer membrane factor family of multidrug eZux proteins from Pseudomonas aeruginosa, a bacterium responsible of nosocomial infections. We report here the two-dimensional (2D) crystallization of OprN and OprM into lipid bilayers and the determination of their 2D projected structure by cryo-electron crystallography, at 1 and 1.4 nm, respectively. Both proteins present a dense ring of protein density, of »7 nm diameter. An additional thin peripheral ring is resolved in OprN structure. Both proteins are assembled as trimers. The results presented here indicate a high structural homology between OprN (and OprM) and TolC, a multidrug eZux protein from Escherichia coli.  2005 Elsevier Inc. All rights reserved. Keywords: Antibiotic resistance; EZux pumps; Outer membrane protein; OprM; OprN; 2D electron crystallography; Cryo-EM

1. Introduction Pseudomonas aeruginosa is a Gram-negative bacterium that causes opportunistic infections in immunocompromised patients and exhibits natural and acquired resistance to diverse antibiotics (Nakae et al., 1997). The broad spectrum of antibiotic resistance presented by P. aeruginosa is mainly due to the synergy of a tight outer membrane barrier and the expression of a number of multidrug eZux (Mex) systems (Nikaido, 1994; Schweizer, 2003). The analysis of the genome sequence of this bacterium has revealed the existence of 12 potential resistance-nodulation-cell division (RND) eZux systems ¤

Corresponding author. Fax: +33 5 40 00 34 84. E-mail address: [email protected] (A. Brisson). 1 These authors contributed equally to this work. 2 M.E. Müller Institute (MSB), Biozentrum, University of Basel, Klingelbergstr. 70, CH-4056 Basel, Switzerland. 1047-8477/$ - see front matter  2005 Elsevier Inc. All rights reserved. doi:10.1016/j.jsb.2005.01.001

(Stover et al., 2000), six of which have been experimentally conWrmed (Aendekerk et al., 2002; Aires et al., 1999; Chuanchuen et al., 2002; Köhler et al., 1997; Poole et al., 1993, 1996). Among these, the MexAB-OprM eZux system is constitutively produced in the wild-type (Nakajima et al., 2002) and the MexEF-OprN is tightly regulated (Köhler et al., 1997). These two eZux pumps have similar patterns of genetic organization. The Wrst gene of each operon encodes a periplasmic membrane fusion protein (MFP) (MexA or MexE), the second encodes a cytoplasmic membrane RND protein (MexB or MexF) presumed to act as a drug-proton antiporter, and the third gene encodes an outer membrane channel-forming factor (OMF) (OprM or OprN). The three proteins are believed to form a complex channel that traverses both membranes and allows the extrusion of drugs directly into the extracellular medium (Mokhonov et al., 2004; Tikhonova et al., 2002; Zgurskaya and Nikaido, 2000). While OprM can function with all RND transporter/MFP complexes

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57

from P. aeruginosa, OprN is more discriminative and does not interact with MexAB (Maseda et al., 2000). OprM and OprN share »30% amino acid sequence identity, and both proteins have been presumed to form oligomers (Masuda et al., 1995). The most similar homolog of OprM and OprN in Escherichia coli is the outer membrane protein TolC, which is also involved in multiple anti-microbial resistance through an energy-dependent eZux mechanism (Fralick, 1996). TolC has been shown to function with AcrA (MFP) and AcrB (RND) (Okusu et al., 1996). Major progresses have already been made with the resolution of the crystal structures of TolC (Koronakis et al., 2000) and AcrB from E. coli (Murakami et al., 2002). TolC is a homotrimer forming a 140 Å-long hollow conduit made of a 100 Å-long periplasmic barrel domain with 12
-helices and a 40 Å -barrel domain forming a single pore within the outer membrane. The AcrB protein forms also a homotrimer, which is believed to be the functional unit (Murakami et al., 2004). In P. aeruginosa, the crystal structure of MexA (MFP) has been reported recently (Akama et al., 2004a; Higgins et al., 2004). On the basis of the X-ray structure and packing of MexA, two models have been proposed to explain the oligomerisation of MexA and the role of the MFP protein in the assembly of the drug eZux pump. It has been originally proposed that OprM and OprN have a structure similar to that of porins and a topological model of OprM has been predicted based on the classical 16-stranded -barrel motif observed for porins (Wong and Hancock, 2000). OprM and OprN share »21 and 14% sequence identity with TolC, respectively. Functionally, both OprM and TolC exhibit channelforming activities after reconstitution into planar lipid bilayer (Andersen et al., 2002; Benz et al., 1993; Eswaran et al., 2003; Yoshihara et al., 2001). In the present study, we report the 2D3 crystallization of OprN and OprM in lipid bilayers and the determination of their 2D projected structure by cryo-electron crystallography, at 1 and 1.4 nm, respectively. The structures are compared with that of TolC (Koronakis et al., 2000).

2. Materials and methods 2.1. Materials and reagents Egg-phosphatidylcholine (egg-PC) and dioleoylphosphatidic acid (PA) were purchased from Avanti Polar Lipids (USA). Octyl-D-glucopyranoside (OG) 3 Abbreviations used: EM, electron microscopy; 2D, two-dimensional; RND, resistance nodulation and cell division; MFP, membrane fusion protein; OMF, outer membrane factor, egg-PC, egg-phosphatidyl-choline; PA, dioleoyl-phosphatidic acid; OG, octyl--D- glucoside; OTG, octyl--D-thioglucopyranoside; Ni–NTA, nickel–nitrilotriacetic Acid.

51

was from either Anatrace (USA) or Sigma. Octyl-D-thioglucopyranoside (OTG) was from Sigma. 2.2. Cloning, expression, and puriWcation of OprM and OprN proteins The oprM and oprN DNA genes of P. aeruginosa (PAO1 strain) were generated separately as NdeI–XmaI fragments with a poly-histidine tag at the C-terminus, using PCR. Each gene was cloned under the control of an arabinose-inducible promoter in the expression vector pBAD33-GFP (Benabdelhak et al., unpublished data; Guzman et al., 1995). The template DNA was extracted from plasmids pOM1“mexAB-oprM” and pKMJ002 “mexEF-oprN,” respectively (Köhler et al., 1997). Primers of the PCR were as follows: OprM (forward: GGAATTCCATATGAAACGGTCCTTCCTT TCC; reverse: TCCCCCCGGGTCAGTGATGGTGA TGGTGATGAGCCTGGGGATCTTCCTTCTTCGC GGTCTG); OprN (forward: GGAATTCCATATGAT TCACGCGCAGTCGATCCGGAGCGGG; reverse: TCCCCCCGGGTCAGTGATGGTGATGGTGATG GGCGCTGGGTTGCCAGCCACCGCCGAG. Proteins were expressed in E. coli strain C43 (DE3) (Miroux and Walker, 1996). Single colonies were picked up and cultures were grown overnight at 37 °C in 500 ml LB medium containing 25 g/ml chloramphenicol. The overnight cultures were sub-cultured in 5 L LB medium containing chloramphenicol and allowed to grow at 30 °C until they reached an OD600 D 2. Cells were induced by the addition of arabinose (Wnal concentration 2 mM), grown for 2 h, and harvested by centrifugation at 8000g for 30 min. The cell pellet was resuspended in 45 ml buVer containing 20 mM Tris–HCl, pH 8, 5 mM MgCl2 and 50 U benzonase (Promega). Cells were broken by a French pressure cell at 10 000 psi and centrifuged twice for 30 min at 8500g to remove the inclusions bodies and unbroken cells. The cytoplasmic fraction was applied on a step sucrose gradient (0.5 and 1.5 M) and centrifuged for 3 h at 200 000g, 4 °C. The pellet corresponding to the outer membrane fraction was resuspended in a solution containing 20 mM Tris-HCl, pH 8, 10% glycerol, 2% OG (Anatrace), and stirred overnight at 23 °C. The solubilized membrane proteins were recovered by centrifugation for 30 min at 50 000g and loaded onto a Ni–NTA resin column pre-equilibrated in 20 mM Tris, pH 8, 10% glycerol, 0.9% OG (buVer A). The column was washed with buVer A plus 10 mM imidazole. The protein was eluted with a linear gradient of imidazole (10–400 mM) at a Xow rate of 5 ml/min. The fractions containing the OprM or OprN proteins eluted between 100 to 250 mM imidazole. They were pooled, concentrated and exchanged for a suitable buVer by gel Wltration chromatography. Finally, each protein was concentrated at 5 mg/ml on “Amicon Ultra” cut-oV 30 000 (Millipore) in the presence of 10% glycerol,

52

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57

20 mM Tris-HCl, pH 8.0, 0.9% OG, and 0.03 mM imidazole. Protein concentration was determined using the Coomassie Plus Protein Assay Reagent “OD595 nm” (PIERCE) method. Samples were analyzed on acrylamide gels (Laemmli, 1970), using a 14% (w/v) acrylamide resolving gel and a 4% stacking gel. Gels were stained using Coomassie brillant blue. 2.3. Reconstitution of OprN and OprM in lipid bilayers and 2D crystallization For 2D crystallization trials, solubilized OprM and OprN proteins were diluted at a Wnal concentration of 0.3 mg/ml in 100 l of a buVer containing 20 mM Tris– HCl, pH 8, 1% OG (Sigma), and supplemented with phospholipids at the desired lipid-to-protein ratio (LPR). After 1 h incubation at room temperature under continuous stirring, the mixture was dialyzed using Spectrapor dialysis bags (MWCO 3500) against 1 L buVer for 1–2 days at room temperature. The reconstituted material was stored at 4 °C. Aliquots were examined daily by electron microscopy (EM) for formation and/or improvement of 2D crystals. 2.4. Electron microscopy and image processing For negative staining, specimens were absorbed for 30 s onto glow-discharged carbon-coated copper grids and stained with 2% uranyl acetate. For cryo-EM, unstained samples were frozen into liquid ethane and the grids were mounted onto a Gatan 626 cryoholder, transferred into the microscope, and kept at a temperature of about ¡175 °C. EM was performed with either a TecnaiF20 or a CM120 FEI-transmission electron microscope, operating at 200 and 120 kV, respectively. Low-dose electron micrographs were recorded either on Kodak SO163 Wlms at a nominal magniWcation of 50 000£ or with a 2 k £ 2 k USC1000 slow-scan CCD camera (Gatan, CA, USA). Images of ice-embedded proteoliposomes and of 2D crystals used in crystallographic analysis were recorded with underfocus values close to 1 m and 200 nm, respectively. The best ordered areas were selected by optical diVraction. Fourier analysis was performed according to standard procedures (Henderson et al., 1986) using the GRIP software provided by Keegstra (http:// rugbe2.chem.rug.nl).

3. Results and discussion 3.1. Expression and puriWcation of the outer membrane proteins OprM and OprN Although we have previously shown that the signalpeptide truncated outer membrane protein OprM can be

Fig. 1. SDS–PAGE analysis of OprM expression and puriWcation. Lane 1, molecular weight markers (MW indicated in kDa). Lanes 2 and 3, total bacterial proteins before and after arabinose induction, respectively. Lane 4, outer membrane fraction after French press and ultracentrifugation on sucrose. Lane 5, detergent-solubilized fraction of outer membrane proteins. Lane 6, insoluble outer membrane fraction. Lanes 7 and 8, puriWed OprN and OprM after Ni2+–NTA chromatography and concentration, respectively. The arrow indicates the position of the puriWed OprM (53.4 kDa) and OprN (51.9 kDa) proteins, respectively.

over expressed in E. coli BL21, puriWed and renatured from inclusion bodies (Charbonnier et al., 2001), attempts of 3D crystallization with this protein material failed so far. As an alternative approach, we used a pBAD expression vector (Guzman et al., 1995) for the production of the recombinant proteins OprM and OprN containing a 6-histidine extension. The P. aeruginosa (PAO1 strain) oprM and oprN open reading frames were cloned into pBAD33-GFPuv with a His6 tag at their C-terminus. Optimized conditions for expression of OprM and OprN proteins were established in which each recombinant protein was addressed and accumulated in the outer membrane (Fig. 1). Over seven non-ionic detergents tested for the solubilization of outer membrane proteins, OG gave the best results. The recombinant proteins were puriWed by aYnity chromatography on a Ni-column and concentrated 20-fold in 20 mM Tris–HCl buVer, pH 8 without salts, containing 0.9% OG, to a Wnal concentration of 5 mg/ ml, with a total net yield of »2 mg per litre of culture. The addition of glycerol 10% ensured prolonged stability of OprM and OprN for at least one week at 4 °C or several months at ¡80 °C. 3.2. 2D crystallization of the outer membrane protein, OprN 2D crystallization trials of OprN were performed at room temperature starting from the micellar protein solution supplemented with phospholipids. The detergent was removed by dialysis over 24–48 h (Jap et al., 1992). The best conditions of reconstitution were obtained with egg-PC, using a dialysis buVer containing 10 mM Tris–HCl, 100 mM NaCl, and 1 mM MgCl2, pH 8. Mixtures of egg-PC/PA (9:1; w/w) and (4:1; w/w) were also tested but gave poorer results.

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57

53

Fig. 2. Reconstitution and 2D crystallization of OprN in lipid bilayers. (A) Large reconstituted proteoliposomes observed by negative staining (scale bar: 1 m). (B) Cryo-EM image of a reconstituted proteoliposome exhibiting annular-shaped OprN particles. Some particles are self-assembled into 2D ordered arrays (scale bar: 50 nm). (C) 2D crystal of OprN molecules (scale bar: 50 nm).

The reconstituted material obtained at LPR close to 1 (w/w) was homogeneous, consisting mainly of large vesicles (»1 m in diameter) appearing collapsed on carbon support Wlms by negative staining (Fig. 2A). The reconstituted membranes presented annular particles of about 7 nm in diameter, either randomly distributed within the membrane surface or assembled into regular 2D arrays (Fig. 2B). Large 2D crystals were obtained after two days of dialysis at room temperature, at an optimal LPR close to 0.75 (Fig. 2C). The addition of 20 mM OTG to OGOprN-eggPC micellar solutions before detergent dialysis led to larger size of the reconstituted structures, as previously described (Chami et al., 2001; Lambert et al., 1999). 3.3. 2D projection structure of OprN The best images of negatively stained 2D crystals of OprN diVracted only to low resolution (around 3 nm). A representative 2D projection map is shown in Fig. 3A.

The unit cell dimensions are 7 £ 7 nm,
D 120°. Repeating motifs with a continuous protein density surrounding a wide stained-Wlled centre are located on a hexagonal lattice. Theses motifs exhibit a conspicuous triangular shape (it must be noted that no symmetry was imposed to Fig. 3A). The best images of frozen-hydrated OprN 2D crystals diVracted up to 1 nm resolution (Fig. 3B). The 2D crystal has the symmetry of the 2D plane group p3 (mean phase residual: 28°). The rather high value of the phase residual reXects the close-to-centrosymmetrical density distribution of the OprN particle. Phase residual values calculated for the other 2D plane groups were signiWcantly larger (38° and 50° for p6 and p2, respectively). The 2D projection map (Fig. 3C) presents triangleshaped motifs, similar to those observed in the negative stain map. The main diVerence between the two maps is the presence, in the unstained map, of a thin annulus of low-density material surrounding the central annular

Fig. 3. 2D projection maps of OprN. (A) Projection map of negatively stained 2D crystal at 3 nm resolution. (B) Fourier transform from an iceembedded 2D crystal. The open circles correspond to diVraction peaks (7, ¡1) and (0, 7), at 1 nm¡1 resolution. (C) 2D projection map of OprN at 1 nm resolution. The protein outer annulus is surrounded by a circle.

54

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57

motif. This low-density material, surrounded by a circle in Fig. 3C and referred to hereafter as the outer annulus, has a width of about 1 nm, and is separated from the central annulus by an area of lower density of 1.5 nm in width. The comparison of the 2D projected structure of OprN with the 3D structure of TolC, a homologous protein from E. coli (Koronakis et al., 2000), provides a direct and straightforward interpretation for the central annulus and the outer annulus structural elements (Fig. 4). TolC is a trimeric membrane protein with an overall cylindrical shape when viewed parallel to the membrane plane (Fig. 4A). It consists mainly of a transmembrane -barrel domain and of an extended
-helical periplasmic domain. Viewed perpendicularly to the membrane plane, TolC presents a continuous protein density, with a slightly triangular shape, together with short protein domains protruding at the periphery, referred to as the equatorial domain by Koronakis et al. (2000) and forming a discontinuous ring (Fig. 4B). From the structural homology between OprN and TolC, we conclude that the central annulus of OprN corresponds to the projection, along a direction perpendicular to the membrane plane, of domains equivalent to the two main domains of TolC, namely the transmembrane barrel domain, and the extended cylindrical
-helical periplasmic domain. In addition, the outer annulus resolved in OprN map must correspond to the equatorial domain from TolC. The fact that structural features corresponding to »60 amino acids are resolved unambiguously in the

Fig. 4. (A and B) Two orthogonal views of the atomic model of TolC trimer (C
trace represented with Rasmol using the atomic coordinates from RCSB Protein data bank code 1EK9). (C) 2D projection map of OprN, represented at the same magniWcation as B. The circle surrounds the protein outer annulus.

Fig. 5. Reconstitution of OprM into lipid membranes. (A) Small reconstituted vesicles with crystalline order (scale bar: 50 nm). (B) Large multilayered 2D crystal (scale bar: 1 m). (C) At high magniWcation, the crystalline array exhibits hexagonal symmetry, diVerent from (A) (scale bar: 50 nm).

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57

EM map is due to the almost vertical orientation of the corresponding
-helices. On the other hand, the outermost segments of the extended
-helices tapering towards the centre in the TolC structure are not resolved in the EM map, due to the oblique orientation of the helices. 3.4. Reconstitution of OprM in lipid bilayers and structural analysis by cryo-EM The reconstitution procedure used for OprN was applied to OprM. Reconstituted lipidic structures were obtained, which consisted almost exclusively of thin stacked layers (Fig. 5). The natural tendency of OprM to

55

form 2D ordered arrays is obvious from the overall aspect of the reconstituted structures, as is the polymorphism of these crystalline assemblies. We selected several of these assemblies on the basis of their apparent packing simplicity, to deduce the molecular structure of OprM. Fig. 6A shows one type of structures—frozen hydrated—exhibiting a hexagonal arrangement of annular particles with a hollow centre, reminiscent of OprN structure. Their unusual high contrast is likely to result from the stacked-layer organization. A 2D projection map (unsymmetrized) corresponding to this arrangement is shown in Fig. 6B. The unit cell dimensions are a D b D 8.3 nm;
D 120°.

Fig. 6. Organization of OprM trimers in thin stacked layers. (A) Cryo-EM image of a multilayered protein crystal (scale bar: 20 nm); note that the protein arrays are stacked in register, producing high contrast. (B) 2D projection map of OprM at 1.4 nm resolution. The unit cell is 8.3 £ 8.3 nm,
D 12°. The contrast has been inverted with respect to Figure A (C) Thin multilayered structures viewed along various orientations (scale bar: 50 nm). Inset, side-view of a three-layer structure (encircled in C). The arrowheads point to four elongated motifs packed side-by-side, about 7-nm apart, which exhibit the basic structural features of TolC molecules viewed parallel to their long axis. The four motifs protrude by about 9–10 nm above a dense double line characteristic of lipid membranes. A dense line corresponding to the position of the peripheral domains is resolved (arrow). Lipid membranes are separated by 12 nm (double arrow) (scale bar: 20 nm). (D) Model of the up-and-down arrangement of OprM trimers in stacked layers. An isolated OprM trimer is represented (top left) with the
-helical periplasmic domain in blue, the peripheral domain in yellow and the transmembrane -barrel domain in red. The arrowheads, arrow and double-arrow point to the same structural elements described in Fig. 6C inset, namely OprM trimers viewed parallel to their long axis, the peripheral domain and the space separating two lipid membranes.

56

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57

Triangular motifs are resolved, with centre-to-centre distance of 4.5 nm. While the triangular motifs of OprM present the same structural characteristics as the central annular density of OprN, the packing of OprM is strikingly diVerent from that of OprN. OprN trimers present a unique orientation in the membrane, are assembled with p3 symmetry and show a centre-to-centre distance of 7 nm, which is imposed by the equatorial domain diameter. On the other hand, the following elements indicate that the hexagonal arrangement of OprM trimers does not correspond to p6 symmetry, but instead that OprM trimers are oriented in an up-and-down manner within the membrane and are assembled—most likely with p321 symmetry: (i) the sequence homology between OprM, OprN and TolC suggests that these proteins present also a structural homology. This is indeed demonstrated above for OprN and TolC. OprM is thus expected to present equatorial domains and have an outer diameter of 7 nm; (ii) the 4.5 nm centre-to-centre distance between OprM annuli is not compatible with a p6 arrangement of trimeric motifs of 7 nm diameter; (iii) some images of properly oriented side views of stacked layers reveal cylindrical particles packed side-by-side with about 7 nm centre-to-centre distance (arrowheads in Fig. 6C inset). These particles exhibit the main structural features of TolC molecules viewed parallel to their long axis, as discussed below; and (iv) thin stacked layers result most often from the assembly of molecules with up-and-down orientations. A detailed analysis of side views of thin stacked layers allows us to propose the model shown in Fig. 6D. Each OprM trimer is represented with three domains, a 10 nm-long cylindrical domain (blue) corresponding to the
-helical periplasmic domain, the peripheral domain (yellow) and the 4 nm-long transmembrane -barrel domain (red). A distance of about 12 nm separates two lipid membranes (double arrow in Fig. 6C inset and D). As clearly resolved in the upper part of Fig. 6C inset, OprM trimers protrude by 9–10 nm above the membrane and are distant by about 7 nm. A thin density at mid-height is resolved (arrow), in keeping with the position of the peripheral domains. The resolution is not suYcient to identify how OprM molecules interact with each other within these 3D assemblies. We conclude therefore that OprM molecules form trimers structurally homologous to OprN and TolC, and are assembled as stacks of oppositely oriented trimers. The only possible 2D space groups with non-orthogonal unit cell compatible with trimeric motifs in up and down orientations are p312, p321 and p622. Although the quality of the crystalline areas was not good enough to provide an unambiguous determination of the symmetry, the data presented above strongly support the symmetry of the plane group p321 (for sake of clarity, several trimers with opposite orientations are numbered 1 and 2 in Fig. 6B). In conclusion, the present study demonstrates that two outer membrane channel-forming proteins from P.

aeruginosa, OprN and OprM, form trimers in reconstituted membranes and present a high structural homology with TolC from E. coli. This result conWrms and extends the conclusions from the sequence analysis study by Wong et al. (2001). Just before submission of this work, the X-ray structure of OprM has been solved, establishing the structural homology between OprM and TolC and conWrming the results shown here (Akama et al., 2004b). This study exempliWes that structural details at 1 nm (and below) are suYcient to classify proteins within families of known structure, stressing the unique role that 2D electron crystallography may play in the structural genomics enterprise.

Acknowledgments This work is supported in part by the 5th Framework European Program (Grant QLR-2000-01339 to AD and AB). The authors thank Dr. Thilo Köhler for kindly providing the MexAB-OprM and MexEF-OprN plasmids. We wish to thank D. Lerouge for technical assistance.

References Aendekerk, S., Ghysels, B., Cornelis, P., Baysse, C., 2002. Characterization of a new eZux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium. Microbiology 148, 2371–2381. Aires, J.R., Kohler, T., Nikaido, H., Plésiat, P., 1999. Involvement of an active eZux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob. Agents Chemother. 43, 2624–2628. Akama, H., Matsuura, T., Kashiwagi, S., Yoneyama1, H., Tsukihara, T., Nakagawa, A., Nakae, T., 2004a. Crystal structure of the membrane fusion protein, MexA of the multidrug transporter in Pseudomonas aeruginosa. J. Biol. Chem. 279, 25939–25942. Akama, H., Kanemaki, M., Yoshimura, M., Tsukihara, T., Kashiwagi, T., Yoneyama, H., Narita, S., Nakagawa, A., Nakae, T., 2004b. Crystal structure of the drug-discharge outer membrane protein, OprM, of Pseudomonas aeruginosa: Dual modes of membrane anchoring and occluded cavity end. J. Biol. Chem. 279, 52816– 52819. Andersen, C., Koronakis, E., Bokma, E., Eswaran, J., Humphreys, D., Hughes, C., Koronakis, V., 2002. Transition to the open state of the TolC periplasmic tunnel entrance. Proc. Natl. Acad. Sci. USA 17, 11103–11108. Benz, R., Maier, E., Gentschev, I., 1993. TolC of Escherichia coli functions as an outer membrane channel. Zentbl. Bakteriol. 278, 187–196. Chami, M., Pehau-Arnaudet, G., Lambert, O., Ranck, J.-L., Levy, D., Rigaud, J.-L., 2001. Use of octyl beta-thioglucopyranoside in twodimensional crystallization of membrane proteins J. Struct. Biol. 133, 64–74. Charbonnier, F., Kohler, T., Pechere, J.-C., Ducruix, A., 2001. Overexpression, refolding, and puriWcation of the histidine-tagged outer membrane eZux protein OprM of Pseudomonas aeruginosa. Protein Expr. Purif. 23, 121–127. Chuanchuen, R., Narasaki, C.T., Schweizer, H.P., 2002. The MexJK eZux pump of Pseudomonas aeruginosa requires OprM for antibiotic eZux but not for eZux of triclosan. J. Bacteriol. 184, 5036– 5044.

O. Lambert et al. / Journal of Structural Biology 150 (2005) 50–57 Eswaran, J., Hughes, C., Koronakis, V., 2003. Locking TolC entrance helices to prevent protein translocation by the bacterial type I export apparatus. J. Mol. Biol. 327, 309–315. Fralick, J.A., 1996. Evidence that TolC is required for functioning of the Mar/AcrAB eZux pump of Escherichia coli. J. Bacteriol. 178, 5803–5805. Guzman, L.M., Belin, D., Carson, M.J., Beckwith, J., 1995. Tight regulation, modulation, and high level expression by vectors containing the arabinose pBAD promoter. J. Bacteriol. 177, 4121–4130. Henderson, R., Baldwin, J.M., Downing, K.H., Lepault, J., Zemlin, F., 1986. Structure of purple membrane from Halobacterium halobium: Recording, measurement and evaluation of electron micrographs at 3.5 Å resolution. Ultramicroscopy 19, 147–178. Higgins, M.K., Bokma, E., Koronakis, E., Hughes, C., Koronakis, V., 2004. Structure of the periplasmic component of a bacterial drug eZux pump. Proc. Natl. Acad. Sci. USA 101, 9994–9999. Jap, B.K., Zulauf, M., Scheybani, T., Hefti, A., Baumeister, W., Aebi, U., Engel, A., 1992. 2D crystallization: From art to science. Ultramicroscopy 46, 45–84. Keegstra, W., GRIP (Groningen Image Processing). Available from: http://rugbe2.chem.rug.nl. Köhler, T., Michea-Hamzehpour, M., Henze, U., Gotoh, N., Curty, L.K., Pechère, J.C., 1997. Characterization of MexEF-OprN, a positively regulated multidrug eZux system of Pseudomonas aeruginosa. Mol. Microbiol. 23, 345–354. Koronakis, V., SharV, A., Koronakis, E., Luisi, B., Hughes, C., 2000. Crystal structure of the bacterial membrane protein TolC central to multidrug eZux and protein export. Nature 405, 914–919. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T7. Nature 227, 680–685. Lambert, O., Moeck, G., Levy, D., Plancon, L., Letellier, L., Rigaud, J.L., 1999. An 8 Å projected structure of FhuA, a ligand-gated channel of the Escherichia coli outer membrane. J. Struct. Biol. 126, 145– 155. Maseda, H., Yoneyama, H., Nakae, T., 2000. Assignment of the substrate selective subunits of the MexEF-OprN multidrug eZux pump of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 44, 658–664. Masuda, N., Sakagawa, E., Ohya, S., 1995. Outer membrane proteins responsible for multiple drug resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 39, 645–649. Miroux, B., Walker, J.E., 1996. Over-production of proteins in Escherichia coli: Mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 260, 289– 298. Mokhonov, V.V., Mokhonova, E.I., Akama, H., Nakae, T., 2004. Role of the membrane fusion protein in the assembly of resistance-nodulation-cell division multidrug eZux pump in Pseudomonas aeruginosa. Biochem. Biophys. Res. Commun. 322, 483–489. Murakami, S., Nakashima, R., Yamashita, E., Yamaguchi, A., 2002. Crystal structure of bacterial multidrug eZux transporter AcrB. Nature 419, 587–593.

57

Murakami, S., Tamura, N., Saito, A., Hirata, T., Yamaguchi, A., 2004. Extra-membrane central pore of multidrug exporter AcrB in Escherichia coli plays an important role in drug transport. J. Biol. Chem. 279, 3743–3748. Nakajima, A., Sugimoto, Y., Yoneyama, H., Nakae, T., 2002. High level Xuoroquinolone resistance in Pseudomonas aeruginosa due to interplay of the MexAB-OprM eZux pump and the DNA gyrase mutation. Microbiol. Immunol. 46, 391–395. Nakae, T., Yoshihara, E., Yoneyama, H., 1997. Multiantibiotic resistance caused by active drug extrusion in hospital pathogens. J. Infect. Chemother. 3, 173–183. Nikaido, H., 1994. Prevention of drug access to bacterial targets: Permeability barriers and active eZux. Science 264, 382–388. Okusu, H., Ma, D., Nikaido, H., 1996. AcrAB eZux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple antibiotic resistance (Mar) mutants. J. Bacteriol. 178, 306– 308. Poole, K., Krebes, K., McNally, C., Neshat, S., 1993. Multiple antibiotic resistance in Pseudomonas aeruginosa: Evidence for involvement of an eZux operon. J. Bacteriol. 175, 7362–7372. Poole, K., Gotoh, N., Tsujimoto, H., Zhao, Q., Wada, A., Yamasaki, T., Neshat, S., Yamagishi, J., Li, X.Z., Nishino, T., 1996. Overexpression of the mexC-mexD-oprJ eZux operon in nfxB-type multidrugresistant strains of Pseudomonas aeruginosa. Mol. Microbiol. 21, 713–724. Schweizer, H.P., 2003. EZux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: Unanswered questions. Genet. Mol. Res. 2, 48–62. Stover, C.K., Pham, X.Q.T., Erwin, A.L., Mizoguchi, S.D., Warrener, P., Hickey, M.J., Brinkman, F.S.L., Hufnagle, W.O., Kowalik, D.J., Lagrou, M., Garber, R.L., Goltry, L., Tolentino, E., WestbrockWadman, S., Yuan, Y., Brody, L.L., Coulter, S.N., Folger, K.R., Kas, A., Larbig, K., Lim, R.M., Smith, K.A., Spencer, D.H., Wong, G.K.S., Wu, Z., Paulsen, I.T., Reizer, J., Saier, M.H., Hancock, R.E.W., Lory, S., Olson, M.V., 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959–964. Tikhonova, E.B., Wang, Q., Zgurskaya, H.I., 2002. Chimeric analysis of the multicomponent multidrug eZux transporters from gram-negative bacteria. J. Bacteriol. 184, 6499–6507. Wong, K.K.Y., Hancock, R.E.W., 2000. Insertion mutagenesis and membrane topology model of the Pseudomonas aeruginosa outer membrane protein OprM.J. Bacteriol. 182, 2402–2410. Wong, K.K.Y., Brinkman, F.S.L., Benz, R.S., Hancock, R.E.W., 2001. Evaluation of a structural model of Pseudomonas aeruginosa outer membrane protein OprM, an eZux component involved in intrinsic antibiotic resistance. J. Bacteriol. 183, 367–374. Yoshihara, E., Maseda, H., Saito, K., 2001. The outer membrane component of the multidrug eZux pump from Pseudomonas aeruginosa may be a gated channel. Eur. J. Biochem. 269, 4738–4745. Zgurskaya, H.I., Nikaido, H., 2000. Multidrug resistance mechanisms: Drug eZux across two membranes. Mol. Microbiol. 37, 219–225.