Molecular detection of diverse Human Immunodeficiency Virus type 1 Groups M, N, O and the Simian immunodeficiency virus (SIVcpz) using generic primers in the transmembrane env region

Chunfu Yang1, Danuta Pieniazek1, Bipin Dash1, Francois Simon2, Guido van der Groen4, Feng Gao3, Beatrice Hahn3, Thomas M. Folks1, and Renu B. Lal1*

2

1HIV/Retrovirus Branch, Division of AIDS, STD, and TB Laboratory Research, NCID, France and 3 Department of Medicine and Microbiology, University of Alabama at Birmingham, Birmingham, 4 Division of Microbiology, Institute of Tropical Medicine, Antwerp, Belgium.

Address correspondence: Renu B. Lal, HIV/Retrovirus Disease Branch, DASTLR/NCID, Centers for Disease Control and Prevention, Mail Stop G-19, 1600 Clifton Road, Atlanta, GA 30333 Tel: (404) 639-1036; Fax: (404) 639-1010; Email: [email protected] Updated: Mar 99 Keywords: HIV-1 subtypes, Group O, plasma viremia, genetic sequence

Abstract The HIV-1 and HIV-2 represent cross-species transmission of primate lentiviruses, and recently the primate reservoir for HIV-1 has been identified as chimpanzee (Pan troglodytes troglodytes). In an effort to amplify all known HIV-1 (group M, N, O) and SIVcpz viruses, we have designed a generic test, referred as gpM-Z, based on the conserved immunodominant region of the transmembrane protein gp41. The primer set can amplify HIV-1 group M (subtypes A-H), group O and group N, as well as 3 chimpanzee viruses (SIVcpzANT, SIVcpzGAB1, and SIVcpzUS) using full length clones, proviral DNA or plasma viral RNA from viral isolates. The assay is highly sensitive in detecting plasma viral RNA from HIV-1 strains of diverse geographic origins representing different subtypes of group M, as well as group O. Further, 245 of the 248 (98.7%) group M plasma specimens (subtypes A=65; B=55, C=21, D=32, E=26, F=33, and G=16), and all (31; 100%) of group O specimens were amplified using the gpM-Z. In vitro spiking experiments further revealed that the assay could detect as few as 10 copy/mL of viral RNA. In addition, analysis of 11 seroconversion panels indicated that the assay is highly sensitive in early detection of plasma viremia during ‘window period’. Thus the highly sensitive molecular assay would not only be useful for early detection of HIV-1, but also be useful tool for identifying new variants of SIVcpz-like viruses in human population.

Introduction Human immunodeficiency virus types 1 (HIV-1) and 2 (HIV-2), the etiologic agent responsible for worldwide AIDS pandemic are characterized by an unusually high genetic diversity (1, 2). Both HIV-1 and HIV-2 viruses have simian counterparts in chimpanzee (simian immunodeficiency virus, SIVcpz) and sooty mangabey (SIVsm), respectively (3). HIV-2 and SIVsm have high degree of genetic homology, suggesting a cross-species transmission (4, 5). Until recently, no such closely related counterpart of HIV-1 group M and group O was described in non-human primates. The three SIVcpz isolates originating from Gabon (SIVcpzGAB1 and GAB2) and Zaire (SIVcpzANT) are structurally related to HIV-1, but divergent enough that they do not cluster with either group M or group O (6, 7). However, a recently identified new isolate, termed group N, was shown to be closely related to SIVcpzGAB (8). Further analysis based on structural genes, and some regulatory genes has revealed that group N virus is equidistant from those of HIV-1 group M and SIVcpzGAB, thus representing a new cross-species transmission (8). More Recent studies indicated that HIV-1 group N is a mosaic of the newly identified chimpanzee virus, SIVcpzUS and HIV-1 related sequences, suggesting an ancestral recombination event in chimpanzee host (9). These investigators have also identified SIVcpz from a subspecies of chimpanzee Pan troglodytes troglodytes as the closest link to current HIV1 epidemic (9). It is clear that zoonotic transmission plays an important role in the emergence of retroviruses (3, 9). It is believed that cross-species transmission of retroviruses probably occurs frequently, however, the subsequent epidemic spread in human population is a rare event. Nevertheless, these zoonosis cases represent a unique opportunity to study the genetic diversity,

however, the adequate detection of such transmission cases may be hampered due to lack of available tools. Thus the systemic surveillance for monitoring emergence of HIV variants worldwide, and for studying the zoonotic transmission of HIV-1 will require highly sensitive molecular screening assays that would not only identify human but also chimpanzee-like viruses in human population. We have recently developed a PCR based assay that allows specific detection of HIV-1 groups M, N and O from plasma and or viral DNA (10, 11). We now report a modified molecular screening tool based on the highly conservative immunodominant region of transmembrane glycoprotein 41 that not only detects all HIV-1 viruses, including groups M, N, and O, but also the highly divergent SIVcpz.

Materials and Methods PCR primers for detection of HIV-1 Groups M, N and O and SIVcpz: We designed primers based on env gp41, namely gpM-Z, for a nested PCR amplification and sequence analysis of group HIV-1 M, N, and O viruses, as well as SIVcpz. The outer primers are same as escribed previously (10) and include gp40F1 (forward): 5' TCTTAGGAGCAGCAGGAAGCACTATGGG ( nt 7789-7816 based on HXB2, GeneBank accession #K03455) and gp41R1 (reverse): 5' AACGACAAAGGTGAGTATCCCTGCCTAA (8347-8374. For the nested PCR, primers are gp46F2 (forward) 5'ACAATTATTGTCTGGTATAGTGCAACAGCA (7850-7879) and gp48R2 (reverse) 5'TCCTACTATCTTAATGAATATTTTTATATA (nt 8265-8294). The primer sequences are highly conserved for HIV-1 group M, N, and O and SIVcpz sequences (http://hivweb.lanl.gov/ALIGN-99/subtype-alignments.html). The PCR amplification conditions using

DNA-PCR and RT-PCR assays for peripheral blood mononuclear cells (PBMC) and plasma, respectively, have been described elsewhere (10). The PCR conditions included denaturation at 94oC for 2 min, followed by 35 cycles of denaturation at 94oC for 30 sec, annealing at 50oC for 30 sec, and extension at 72oC for 60 sec, with a final extension at 72oC for 5 min. The sensitivity of the gpM-Z primers was determined by spiking known copy numbers of HIV-1 stock in normal human plasma at 1000, 100, 50, 25, 10 and 1 copies/mL obtained from (Abbott Laboratories, North Chicago). In addition, the sensitivity of the assay for HIV-1 group M subtypes A-H was also tested using near-full length virus clones at 100, 10, 5 and 1 copies per 100µL PCR reaction (12). Viral Isolates: Viral isolates representing various HIV-1 subtypes and SIV isolates were expanded as described previously (10). The SIVsm isolates were either obtained from the AIDS Reagent and Reference Program or primary isolates obtained from naturally infected monkeys (unpublished). DNA or RNA of SIVcpz isolates, SIVcpzGAB1, SIVcpzANT and SIVcpzUS, were also obtained (6, 7, 9). Viral RNA was extracted from the culture supernatants and tested for initial sensitivity and specificity of the primers. Study Subjects: Specimens used in the present study are part of various ongoing HIV-1 studies worldwide, as described previously (10). RNA was extracted from serum and/or plasma specimens from Uganda (n=58), Cameroon (n=23), Ivory Coast (n=36), Ghana (n=21), Zimbabwe (n=8), Mozambique (5) S. Africa (n=1), Argentina (n=29), Brazil (n=23), USA (n=5), Canada (n=1), China (n=3), Thailand (47), Japan (n=3) India (n=2), Lebanon (n=9) and Spain (n=5). The

specificity of the assay was determined using specimens from 41 HIV seronegative donors from the US and 16 HIV-2 positive specimens from West Africa. Eleven HIV-1 seroconversion panels were also obtained from Boston Biomedica Inc., (Boston, MA). All specimens were genotyped by phylogenetic analysis of envelope (C2V3 or gp41) region of HIV-1 genome by DNA-PCR using uncultured peripheral blood lymphocytes, or RT-PCR using plasma, as described previously (10). Phylogenetic analysis: Reversed transcribed cDNA, or viral DNA was cycle-sequenced in both directions with fluorescent-dye-labeled sequencing terminators. The sequences were aligned using the CLUSTAL version V multiple sequence alignment program and the gaps and region flanking the gaps were trimmed until a reliable alignment could be established to eliminate the source of random and systematic errors. A phylogenetic analysis of the gp41 sequences was performed as described previously (11), using group M reference sequences from both full length genomes (11) and commonly used marker sequences of subtypes A-H (2), group O sequences ANT70 and MVP5180, group N sequence HIVYBF30, and chimpanzee viral sequences of SIVcpzANT, SIVcpzGAB1 and SIVcpzUS strains. Phylogenetic analysis was done using the maximumlikelihood method with the fast DNAml program, version 1.0.8 and the neighbor joining method included in the Phylip 3.5c package with or without bootstrapping. The stability of the tree topology was tested as needed by pruning method, which consists of removing one species from the alignment and rerunning the phylogenetic analysis.

Results Amplification of HIV-1 groups M, N, O and SIV cpz: Viral DNA from nearly full length molecular clones representing HIV-1 groups M and viral isolates representing HIV-1 group N (YBF-30), and SIVcpz (SIVcpzANT and SIVcpzUS), as well as viral RNA from HIV-1 group O (BCF1, BCF2, BCF3, and 3012) and SIVcpzGAB1 were tested for amplification by gpM-Z primer set. The gpM-Z primers were able to amplify as few as 1 to 5 copies of the nearly full-length clones of HIV-1 group M subtypes A-H (Fig 1A). Likewise, gpM-Z primers also gave a positive amplification from viral isolates representing group O (BCF1-3, 3012), and group N (YBF30) (Fig 1B). More importantly, analysis of two simian isolates (SIVcpzGAB1, SIVcpzUS) derived from the chimpanzee subspecies of Pan troglodytes troglodytes, which phylogenetically clusters close to HIV-1 group N (9), revealed that both isolates could be amplified by gpM-Z primers. In addition, another SIVcpzANT isolate, which is significantly distant to SIVcpzGAB1 and SIVcpzUS, also amplified with the gpM-Z primers (Fig 1b). In contrast, analysis of 10 SIVsm isolates showed no amplification (data not shown). We next examined the amplification efficiency of gpM-Z primers from plasma specimens representing groups M (n=248) and group O (n=31) from diverse geographic regions. Of the 248 HIV-1 group M, 245 (sensitivity 98.8%) specimens including subtypes A (65/65; 100%), B (54/55; 98%), C (21/21; 100%), D (32/32; 100%), E (26/26; 100%), F (32/33; 97%) and G (15/16; 93%) were amplified by gpM-Z primers (Fig 1c). Indeed, in vitro spiking of HIV-1 subtype B with known copies in the plasma established that the gpM-Z primers can reliably detect as few as 10 copies/ml of HIV-1 RNA (data not shown). Further, plasma specimens from

HIV-1 infected persons where viral load was