J. Mol. Biol. (2007) 371, 317–322

doi:10.1016/j.jmb.2007.04.087

Recruitment of RNA Polymerase II in the Ifng Gene Promoter Correlates with the Nuclear Matrix Association in Activated T Helper Cells Elvira R. Eivazova 2 , Sergei A. Markov 3 , Iryna Pirozhkova 1 Marc Lipinski 1 and Yegor S. Vassetzky 1 ⁎ 1

UMR 8126, CNRS Université Paris-Sud 11, Institut de Cancérologie Gustave-Roussy, F-94804 Villejuif, France 2

Vanderbilt University School of Medicine, Department of Medicine, Nashville, TN 37232, USA 3

Austin Peay State University, Department of Biology, Clarksville, TN 37044, USA

Recruitment of the RNA polymerase II transcription complex to the promoter of the Ifng gene has been studied by chromatin immunoprecipitation (ChIP) in activated functionally different CD4+ T helper (Th) cell subsets. In parallel, analysis of association of the nuclear scaffold/matrix with the Ifng gene promoter has been carried out. The RNA polymerase II (RNA pol II) interacted with the Ifng gene promoter in analyzed activated neutral Th cells, IFN-γ producing Th1 cells and IFN-γ silent Th2 cells. However, the interaction of the Ifng gene promoter with the nuclear matrix occurred differentially in a lineage-specific manner. The pattern of the nuclear matrix interaction correlated directly with the gene expression. Strong association of the promoter with the nuclear matrix was observed only in the Th1 cell subset where the Ifng gene was actively transcribed. We propose that it is the interaction of the Ifng gene promoter with the nuclear matrix that may set off transcription in activated Th cells by promoterassociated RNA pol II. © 2007 Elsevier Ltd. All rights reserved.

*Corresponding author

Keywords: chromatin immunoprecipitation (ChIP); Ifng gene promoter; RNA polymerase II; transcription factors; nuclear scaffold/matrix

Introduction Transcription in higher eukaryotes is triggered by a complex combination of events, including interactions of RNA polymerase II (pol II) and the transcriptional factors with promoters/enhancers, interactions of promoters with distant control elements such as insulators and locus control regions, and selective interactions of genes with the nuclear matrix1. Nucleosomes may suppress gene expression by blocking the binding of transcription factors to DNA, thus acting as a barrier to RNA pol II elongation. The nuclear matrix is involved in positive/negative gene regulation via permanent and transient interactions with specific DNA sequences Abbreviations used: pol II, polymerase II; Th, T helper; ChIP, chromatin immunoprecipitation; TF, transcription factor; PIC, pre-initiation complex; TCR, T cell receptor; mAb, monoclonal antibody; LIS, lithium 3,5-diiodosalicylate. E-mail address of the corresponding author: [email protected]

called S/MARS. 2,3 Therefore, gene activation requires alteration of chromatin structure to facilitate formation of active transcription complex at a gene promoter. Chromatin remodeling complexes and histone modifying complexes each play an important role in generating these changes. The next crucial step in the transcriptional gene regulation is the positioning of RNA pol II onto the gene promoter and formation of a pre-initiation complex (PIC)4,5. Mechanisms of transcriptional regulation with involvement of RNA pol II and locus control region (LCR) in the families of coordinately expressed genes have been described.6 However, the patterns of RNA pol II interaction with the promoters in the course of activation and silencing in the genes that lack LCR remain unclear. Here we aimed to follow the interaction of RNA pol II complex with the promoter region of Ifng gene at different states of activation in CD4+ Th cell subsets. The Th1 and Th2 CD4+ cell subsets represent a model study system for transcriptional regulation. Both Th lineages originate from naïve unactivated T helper (Th) cells, but develop mu-

0022-2836/$ - see front matter © 2007 Elsevier Ltd. All rights reserved.

318 tually exclusive effector functions under specific conditions that result in actively transcribed Ifng gene in Th1 cells, and its silencing in Th2 cells.7–9 Activation of naive T cells via T cell receptor (TCR) alone induces neutral Th cell subsets that express the Ifng gene at negligible levels, and does not lead to substantial production of the IFN-γ cytokine. We used chromatin immunoprecipitation (ChIP) and matrix attachment (S/MAR) analysis to determine the relationship between recruitment of the RNA pol II transcription machinery and S/MAR interactions in the promoter in differentially expressed Ifng gene.7–9 The combination of these methods aimed to provide a closer look at the interplay between the transcription and the chromatin organization in the active and silenced Ifng gene. We have found that the binding of RNA pol II with the Ifng gene promoter was detected in all analyzed activated Th cell subsets regardless of their transcriptional status. RNA pol II was recruited to the promoter in activated neutral Th cells, and remained there in Th1 cells and in Th2 cells. On the other hand, the analysis of interaction of the Ifng gene promoter with the nuclear matrix has shown prominent association of the promoter with the nuclear matrix, but only in Th1 cells where active transcription took place. Thus, differential patterns of binding in activated functionally different Th cell subsets underlay differences in the Ifng gene expression. We propose that the interaction of the Ifng gene promoter with the nuclear matrix might be required to set off transcription by promoterassociated RNA polymerase II.

Recruitment of RNA Polymerase II

interactions with the Ifng gene. These cell lineages display the following characteristics. Activated neutral Th cells express the Ifng gene at negligible levels, and do not show substantial production of the IFN-γ cytokine. Th1 effector lineage actively transcribes the Ifng gene and produces IFN-γ, and Th2 lineage silences the Ifng gene and does not produce IFN-γ (Figure 1). ChIP assay was conducted as described12 using specific antibodies that recognize BAF 155, BAF 170, TFIID (TBP) basal transcription factor and RNA pol II. We isolated nuclei from Th cells of different lineages as described in Material and Methods. The cross-linked DNA was sonicated to shear DNA and immunoprecipitated using specific antibodies; rabbit IgG was used as control. The cross-links were reversed by heating; DNA was purified and specifically amplified using primers specific for the Ifng gene promoter. The results of the ChIP assay revealed that BAF155 and BAF170 subunits of SWI/SNF, and TFIID, a basic component of the RNA pol II transcription machinery, were bound to the promoter in activated neutral Th cells (Figure 2). No interaction was detected in Th1 or Th2 cells. In contrast, RNA pol II was bound to the gene promoter in activated neutral Th cells, and in effector Th1 and Th2 cells. General transcription factor TFIID was reported to be associated with essentially all promoters during transcriptional initiation.13 Upon recruitment of

Results and Discussion Interaction of RNA polymerase II transcription complex with the Ifng gene promoter in activated Th cells The SWI/SNF multi-subunit complex remodels nucleosomes and, therefore, plays an important role in initiation of eukaryotic gene transcription. Some studies suggest that the complex can be recruited independently from RNA pol II, helps activator binding, and facilitates subsequent steps in transcriptional activation, such as the binding of TATAbox binding protein (TBP).10,11 Subunits BAF 155 and BAF 170 make the functional core of SWI/SNF complex, remodeling nucleosome structure in ATPdependent manner during histone acetylation. Since RNA pol II and transcription factors class II (TFII family) are required for initiation of transcription, we aimed to analyze distribution of transcription factors at the Ifng gene promoter in functionally different Th subsets. The first step in formation of initiation complex is binding of TFID to TATA box located upstream of the transcription start codon, followed by assembly of RNA pol II into the complex. Here we analyzed functionally different neutral, Th1 and Th2 CD4+ cell subsets to define binding

Figure 1. IFN-γ production in CD4+ Th cells. IFN-γ production in CD4+ Th cells in neutral and effector Th cells was measured in culture fluids by standard ELISA. Purified CD4+ Th cell subsets were activated with platebound anti-CD3 mAb and analyzed after primary stimulation and secondary stimulation. Th cells cultured under neutral conditions received no additional additives; cells under Th1 conditions received IL-12 and anti-IL-4 mAb, and cells under Th2 conditions received IL-4 and anti-IFN-γ mAb. IFN-γ production was measured at day 1, day 5 and day 7.

Recruitment of RNA Polymerase II

319

Figure 2. Selective association of RNA polymerase II complex with the Ifng gene promoter in neutral, Th1 and Th2 cells. C57Bl/6 CD4+ T cells were purified, TCRstimulated and cultured under neutral, Th1 and Th2 conditions. At day 2 after the secondary stimulation the cells were harvested and processed for ChIP assay using specific mAbs. Shown is binding for anti-pol II, anti-BAF 155, anti-BAF 170, and anti-TFIID (TBP) immunoprecipitates. Input control: aliquots of purified total genomic DNA were amplified by PCR without immunoprecipitation; control for binding specificity: immunoprecipitates with polyclonal rabbit IgG.

RNA pol II and formation of the PIC, it dissociates from the PIC. Therefore, the fact that TFIID is associated with the Ifng gene in activated neutral Th cells is not surprising. We reason that this may explain why there was no interaction detected with anti-TFIID antibody in Ifng transcribing Th1 and Ifng silent Th2 cells. It is not clear whether nucleosome remodeling SWI/SNF complex, that functions to make chromatin more assessable for binding of transcription factors, interacts with RNA pol II. Some data suggest that it could interact either directly or indirectly with transcription factors,14 and be recruited to the promoter before initiation of transcription, similar to what we observed with BAF155/BAF170 binding at the Ifng gene promoter in activated neutral Th cells. While the association of BAF complex with the nuclear matrix and chromatin was shown during T-lymphocyte activation,15 no specific data exist on SWI/SNF complex-dependent activation of genes during Th cell maturation and differentiation. At the same time, RNA pol II was bound at the Ifng gene promoter, remaining during silent and ongoing transcription adopting a pre-poised state. The rapid transcription of cytokine genes under TCR activation suggests that these genes are left acces-

sible to the general transcription machinery in response to specific stimuli after the gene activation. Study of IL-4 cytokine gene family in effector Th1 and Th2 cells also supports the presence of a prepoised conformation.16–18 Indeed, neutral Th cells can be driven to differentiate into either Th1 or Th2 lineages, but Th1 and Th2 cell subsets still retain the potential to reverse cytokine production of their original phenotype under application of lineagespecific conditions.9 The data suggest that in such pre-poised state RNA pol II in the Ifng gene is accessible for interaction with regulatory elements and transcription factors and can facilitate rapid transcriptional activation or silencing upon application of a specific trigger. Ifng gene promoter interacts with the nuclear matrix in Th1 cells Transcription leads to transient association of the transcriptional complexes with the nuclear matrix.19,20 Using oligonucleotide DNA array technique, we performed S/MAR analysis of the association of the promoter with the nuclear matrix in activated neutral Th cells and in Th1 and Th2 subsets. Nuclear matrix-associated DNA was isolated from these cells using a standard technique: isolated nuclei were treated with DNase I and then extracted with 2 M NaCl, as described in Materials and Methods. Nuclear matrix-associated DNA was used for hybridization with short oligonucleotide arrays, consisting of three specific 29–31-mers, spaced 1 kb apart around the Ifng gene promoter, and compared with the positive control, a ubiquitous structural S/MAR from the murine kappa immunoglobulin gene locus21,22 (Table 1). Weak association with the nuclear matrix was observed in activated neutral Th cells (Figure 3). The Ifng gene promoter region did not interact with the nuclear matrix in Th2 cells. In contrast, a significant association of the promoter region with the nuclear matrix was observed in transcriptionally active Th1 cells which correlate directly with Ifng gene expression in analyzed Th cells. Thus, changes in association of the Ifng gene promoter to the nuclear matrix correspond to differences in gene expression. In order to demonstrate that the association of the Ifng gene promoter to the nuclear matrix in Th1 cells is not structural, but indeed transcription-related, we have treated isolated nuclei with weak anionic detergent lithium 3,5-diiodosalicylate (LIS). LIS causes dissociation of histone and non-histone pro-

Table 1. Sequences of the oligonucleotides used in the DNA array and their relative positions in the Ifng gene domain Designation +1 0 −1 Igg MAR NA, not applicable.

Position relative to the Ifnγ gene transcription start site

Sequence of the oligonucleotides

− 943 + 11 + 979 NA

TTAATCCTTATTTGGGACAAGTGTGTG ATCGGCTGACCTAGAGAAGACACAT ATGAAGCCCTATTACAGCACAGACT TTAGAGGTAAAATCTACAGCCAGCAAAAGT

320

Recruitment of RNA Polymerase II

Figure 3. Mapping the association of the Ifng gene promoter to the nuclear matrix by oligonucleotide DNA array technique. DNA attached to the nuclear matrix was radiolabeled and hybridized with the DNA oligonucleotide array to probe the promoter region of the Ifng gene. The data were calculated as a ratio of hybridization of nuclear matrix normalized against a positive control, a ubiquitous MAR from the murine kappa immunoglobulin gene locus and assigned a value of 100 (Igg MAR). The average of three independent experiments (two hybridizations per experiment) is presented. Shown are: axes X, position of oligonucleotides along the Ifng gene sequence relative to transcription start site; axes Y, relative hybridization intensity for matrix attachment interaction, expressed in relative units. Th0, Th1, Th2, hybridization with the NaCl or LIS-extracted nuclear matrix from the Th cell subsets.

teins,20,23 particularly RNA pol II transcription complexes, 20 but maintains the interactions of structure-related S/MARs, such as the S/MAR from the murine kappa immunoglobulin gene locus with the resulting nuclear matrix. Nuclei isolated from Th lymphocyte subsets, were pre-treated with DNase I followed by LIS extraction, according to standard protocol,24 and used for hybridization with oligonucleotide arrays. We found that LIS-treated nuclear matrix-associated DNA from Th1 cells showed considerably reduced levels of interaction with the Ifng gene promoter (Figure 3). No change in the pattern of DNA hybridization with the nuclear matrix was observed in LIS-treated bone neutral Th and Th2 cells. These data provide evidence that transient interaction with the nuclear matrix found in the Ifng gene promoter in Th1 cells results from ongoing active transcription. The results from long-range histone acetylation analysis by ChIP in the Ifng gene provide information that histone acetylation was stretched along the Ifng gene outside of the promoter at least for 100 kb.25 Interestingly, similar interaction with pol II was described for the β-globin gene family in which pol II resides on LCR, but could interact with promoters of sequentially expressed globin genes in the spatially organized locus by a looping mechanism.26 We have shown previously that the formation of the loop conformation in the Ifng gene around the promoter/

first intron implies that the gene, transcription machinery, and distal enhancers and silencers can achieve close spatial proximity and be accessible for interaction. Based on the fact that in functionally different Th cell subsets, the RNA pol II is associated with the Ifng gene promoter in a pre-poised state, we propose that activation or silencing of the Ifng gene can be achieved over distance creating a mechanism that permits conditional cell-type-specific gene transcription.16 Thus, the presence of RNA pol II at the Ifng gene promoter per se is not sufficient to drive expression of the gene, and requires S/MAR interaction between promoter and the nuclear matrix. We propose that such interaction facilitates transcription by promoter-associated RNA pol II, underlining the differences in active and silent Ifng gene.

Materials and Methods Cell cultures and cytokine staining CD4+ Th cells were freshly isolated from spleens of fourweek-old C57BL6 mice. Cell cultures were performed by standard methods, essentially as described.16 CD4+ T cells were purified by negative selection using magnetic beads (Genome Therapeutics, Waltham, MA). Tissue culture plates were coated with 10 μg/ml anti-CD3 monoclonal

Recruitment of RNA Polymerase II antibody (mAb) (145-2C11 clone, American Type Culture Collection) overnight at 4 °C and thoroughly washed with HBSS. Purified CD4+ T cells (1 × 106 per ml) were TCR stimulated with plate-bound anti-CD3 mAb and syngenic irradiated spleen cells at a density of 1 × 106 cells per ml in RPMI medium 1640 containing 10% (v/v) FCS, 100 units/ml penicillin, 100 units/ml streptomycin, 2 mM −5 L-glutamine, and 5 × 10 M 2-mercaptoethanol. Effector Th1 and Th2 lineages were prepared in culture for five days (primary stimulation) under neutral (no further additives), Th1 (5 ng/ml recombinant mouse IL-12 (BD Pharmingen), and 10 μg/ml anti-IL-4 mAb (11B11, American Type Culture Collection)), or Th2 (5 ng/ml IL-4 (BD Pharmingen) and 10 μg/ml anti-IFN-γ mAb) conditions. Cells were re-stimulated with plate-bound anti-CD3 mAb without addition of cytokines and cultured again for two days. IFN-γ was measured during the time-course of CD4+ Th cell cultures by standard cytokine ELISA.16 Nuclei and nuclear matrices Nuclei were purified from freshly isolated murine cells or cell cultures. Nuclear matrices were prepared by treatment of the isolated nuclei with DNase I followed by extraction with 2 M NaCl essentially as described.27 The size distribution of the loop domain attachment sites (the matrix–bound DNA fragments) was in the range of 200– 1000 bp. The fraction of the loop domain attachment sites constituted 2–5% of the total DNA. Nuclear matrices were digested with proteinase K and extracted with phenolchloroform. Isolated nuclear matrix DNA was treated with RNase A and, after labeling, used as a probe in a Southern/ dot blot with the oligonucleotide probes covering the 2 kb around the murine Ifng gene promoter. Nuclear matrices obtained from three independent experiments were used for hybridizations. Each labeling/hybridization experiment has been carried out in duplicate. Similar amounts of DNA were taken for the labeling reaction and signal levels detected after the hybridization were not significantly different. Isolated nuclei were subjected to extensive treatment with DNase I, under the conditions similar to those used for in vivo footprinting in order to digest non-proteinassociated DNA. Subsequent extraction of the nuclei in a high-salt buffer removed histones and other highly soluble proteins with associated DNA.24 The remaining nucleoskeleton contained chromatin loop anchorage regions. This DNA fraction was purified, radiolabeled and used as a probe to examine the promoter region. The oligonucleotides covering 2 kbp of the promoter region of the murine Ifng gene and a positive control, a ubiquitous S/MAR from the murine kappa immunoglobulin gene locus22; Table 1) were slot-blotted onto Zeta-probe GT filters in 0.4 M NaOH and fixed by baking at 80 °C for 30 min. Each filter contained the mini-array in duplicate. The hybridization was carried out at 60 °C in modified Church buffer (0.5 M phosphate buffer (pH 7.2), 7% (w/v) SDS, 10 mM EDTA) overnight. The blot was washed subsequently in 2× SSC, 0.1% SDS twice for 5 min, then in 1× SSC, 0.1% SDS, twice for 10 min. The blots were exposed using Kodak PhosphoScreens and analyzed on Fuji FLA-3000 PhosphoImager for 3–72 h. All experiments were done in triplicate. The data were normalized versus a positive control (a ubiquitous MAR from the murine kappa immunoglobulin gene locus) as described.27 To test for significance, a statistical analysis of data was done by Student's t test. A significance level of 0.1 was chosen.

321 Chromatin immunoprecipitation (ChIP) assays ChIP assay was performed essentially as described.12 Briefly, neutral, Th1 and Th2 cell cultures were harvested washed and counted to 1 × 107 T cells. Cells were fixed with 1% paraformaldehyde and lysed in 1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1). Lysates were sonicated to achieve an average length of genomic DNA of about 500 bp. Protein-DNA complexes were immunoprecipitated overnight at 4 °C with antibodies against RNA polymerase II, anti-BAF 155/BAF170, anti-TFIID (TBP) (Santa Cruz Biotechnology), or normal rabbit IgG (Sigma) as control. Protein-DNA complexes were purified with protein A-agarose. Aliquots (20 μl) were processed without immunoprecipitation as input controls. DNA was purified after reversal of cross-linking at 65 °C. PCR primers were designed to span the −120 kb to +115 kb region of the Ifng gene promoter. The optimal primer sequences used for PCR amplification were as follows: forward primer sequence is 5GCTCCCCCCACCTATCTGTCACCATCTTAAAA 3′ and reverse primer sequence is 5′ TGCAGTGTGTAGCGTTCATTGTCTCAGAG 3. Standard PCR conditions were used for 35 cycles. PCR products were resolved by agarose gel electrophoresis, and image intensities were obtained by using the Stratagene Eagle Eye imaging and software packages. All experiments were run in duplicates and repeated at least three times.

Acknowledgements We thank Dr Olga Iarovaia for critical reading of the manuscript. The research in Y.V.'s laboratory is supported by the Association Française contre les Myopathies (AFM), PICS 3207 and the Fondation de France. I.P. was a recipient of the AFM postdoctoral fellowship.

References 1. Hahn, S. (2004). Structure and mechanism of the RNA polymerase II transcription machinery. Nature Struct. Mol. Biol. 11, 394–403. 2. Stein, G. S., van Wijnen, A. J., Stein, J. L. & Lian, J. B. (1999). Interrelationships of transcriptional machinery with nuclear architecture. Crit. Rev. Eukaryot. Gene Expr. 9, 183–190. 3. Vassetzky, Y., Hair, A. & Mechali, M. (2000). Rearrangement of chromatin domains during development in Xenopus. Genes Dev. 14, 1541–1552. 4. Soutoglou, E. & Talianidis, I. (2002). Coordination of PIC assembly and chromatin remodeling during differentiation-induced gene activation. Science, 295, 1901–1904. 5. Studitsky, V. M., Walter, W., Kireeva, M., Kashlev, M. & Felsenfeld, G. (2004). Chromatin remodeling by RNA polymerases. Trends Biochem. Sci. 29, 127–135. 6. Johnson, K. D., Christensen, H. M., Zhao, B. & Bresnick, E. H. (2001). Distinct mechanisms control RNA polymerase II recruitment to a tissue-specific locus control region and a downstream promoter. Mol. Cell, 8, 465–471. 7. Flanagan, J. F. & Peterson, C. L. (1999). A role for the

Recruitment of RNA Polymerase II

322

8. 9. 10.

11.

12.

13.

14.

15.

16.

17.

yeast SWI/SNF complex in DNA replication. Nucl. Acids Res. 27, 2022–2028. Glimcher, L. H. & Murphy, K. M. (2000). Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14, 1693–1711. Grogan, J. L. & Locksley, R. M. (2002). T helper cell differentiation: on again, off again. Curr. Opin. Immunol. 14, 366–372. Sudarsanam, P., Cao, Y., Wu, L., Laurent, B. C. & Winston, F. (1999). The nucleosome remodeling complex, Snf/Swi, is required for the maintenance of transcription in vivo and is partially redundant with the histone acetyltransferase, Gcn5. EMBO J. 18, 3101–3106. Yudkovsky, N., Logie, C., Hahn, S. & Peterson, C. L. (1999). Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators. Genes Dev. 13, 2369–2374. Zhou, W., Chang, S. & Aune, T. M. (2004). Long-range histone acetylation of the Ifng gene is an essential feature of T cell differentiation. Proc. Natl Acad. Sci. USA, 101, 2440–2445. Struhl, K., Kadosh, D., Keaveney, M., Kuras, L. & Moqtaderi, Z. (1998). Activation and repression mechanisms in yeast. Cold Spring Harbor Symp. Quant. Biol. 63, 413–421. Lee, C. H., Murphy, M. R., Lee, J. S. & Chung, J. H. (1999). Targeting a SWI/SNF-related chromatin remodeling complex to the beta-globin promoter in erythroid cells. Proc. Natl Acad. Sci. USA, 96, 12311–12315. Zhao, K., Wang, W., Rando, O. J., Xue, Y., Swiderek, K., Kuo, A. & Crabtree, G. R. (1998). Rapid and phosphoinositol-dependent binding of the SWI/SNFlike BAF complex to chromatin after T lymphocyte receptor signaling. Cell, 95, 625–636. Eivazova, E. R. & Aune, T. M. (2004). Dynamic alterations in the conformation of the Ifng gene region during T helper cell differentiation. Proc. Natl Acad. Sci. USA, 101, 251–256. Spilianakis, C. G. & Flavell, R. A. (2004). Long-range

18. 19. 20.

21. 22.

23.

24.

25.

26.

27.

intrachromosomal interactions in the T helper type 2 cytokine locus. Nature Immunol. 5, 1017–1027. Gasser, S. M. (2002). Visualizing chromatin dynamics in interphase nuclei. Science, 296, 1412–1416. Ciejek, E. M., Tsai, M. J. & O'Malley, B. W. (1983). Actively transcribed genes are associated with the nuclear matrix. Nature, 306, 607–609. Roberge, M., Dahmus, M. E. & Bradbury, E. M. (1988). Chromosomal loops/nuclear matrix organization of transcriptionally active and inactive RNA polymerases in HeLa nuclei. J. Mol. Biol. 201, 545–555. Cockerill, P. N. & Garrard, W. T. (1986). Chromosomal loop anchorage sites appear to be evolutionarily conserved. FEBS Letters, 204, 5–7. Cockerill, P. N. & Garrard, W. T. (1986). Chromosomal loop anchorage of the kappa immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites. Cell, 44, 273–282. Yasui, D., Miyano, M., Cai, S., Varga-Weisz, P. & Kohwi-Shigematsu, T. (2002). SATB1 targets chromatin remodelling to regulate genes over long distances. Nature, 419, 641–645. Gasser, S. M. & Vassetzky, Y. S. (1998). Analysis of nuclear scaffold attachment regions. In Chromatin: A Practical Approach (Gould, H. ed.), pp. 111–124, Oxford University Press, Oxford. Chang, S. & Aune, T. M. (2005). Histone hyperacetylated domains across the Ifng gene region in natural killer cells and T cells. Proc. Natl Acad. Sci. USA, 102, 17095–17100. Johnson, K. D., Grass, J. A., Park, C., Im, H., Choi, K. & Bresnick, E. H. (2003). Highly restricted localization of RNA polymerase II within a locus control region of a tissue-specific chromatin domain. Mol. Cell. Biol. 23, 6484–6493. Ioudinkova, E., Petrov, A., Razin, S. V. & Vassetzky, Y. S. (2005). Mapping long-range chromatin organization within the chicken alpha-globin gene domain using oligonucleotide DNA arrays. Genomics, 85, 143–151.

Edited by J. Karn (Received 16 January 2007; received in revised form 20 April 2007; accepted 20 April 2007) Available online 18 May 2007