Neuroscience Letters 451 (2009) 237–240

Contents lists available at ScienceDirect

Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet

Effects of transient focal cerebral ischemia in mice deficient in puma Katsura Kuroki a,b , Isabelle Virard a , Caoimhin G. Concannon a , Tobias Engel a , Ina Woods a , Waro Taki b , Nikolaus Plesnila a , David C. Henshall a , Jochen H.M. Prehn a,∗ a b

Department of Physiology and Medical Physics, Royal College of Surgeons in Ireland, 123 St. Stephen’s Green, Dublin 2, Ireland Department of Neurosurgery, Mie University School of Medicine, Tsu, Mie, Japan

a r t i c l e

i n f o

Article history: Received 17 September 2008 Received in revised form 7 January 2009 Accepted 7 January 2009 Keywords: Apoptosis Bax Bcl-2 Endoplasmic reticulum stress p53 Programmed cell death Stroke

a b s t r a c t Bcl-2 homology domain 3 (BH3)-only pro-apoptotic proteins may play an important role in upstream cell death signaling pathways underlying ischemic brain injury. Puma is a potent BH3-only protein that can be induced via p53, FoxO3a and endoplasmic reticulum stress pathways and is upregulated by global cerebral ischemia. To more completely define the contribution of Puma to ischemic brain injury we measured the expressional response of Puma to transient focal cerebral ischemia in mice and also compared infarct volumes in puma-deficient versus puma-expressing mice. Real-time quantitative PCR determined puma mRNA levels were significantly increased 8 h after 90 min middle cerebral artery (MCA) occlusion in the ipsilateral cortex, while expression remained unchanged contralaterally. Puma protein levels were also increased in the ischemic cortex over the same period. However, cortical and striatal infarct volumes were not significantly different between puma-deficient and puma-expressing mice at 24 h, and no differences between genotypes were found for post-ischemic neurological deficit scores. These data demonstrate that focal cerebral ischemia is associated with puma induction but suggest that Puma does not contribute significantly to lesion development in the present model. © 2009 Elsevier Ireland Ltd. All rights reserved.

Programmed cell death signaling pathways are important contributors to ischemic brain damage and other acute neurologic insults [11]. Focal ischemia activates the c-Jun N-terminal kinase, p53 and FoxO3a transcription factor pathways culminating in mitochondrial release of apoptogenic molecules and downstream caspase-dependent and -independent neuronal death [3,4,14,21]. Endoplasmic reticulum stress may also contribute to the ischemic cell death process [7,20]. Accordingly, there is significant interest in elucidating the functional contribution of signaling intermediates within these pathways. Bcl-2 family proteins are a major class of molecule determining mitochondrial homeostasis, which influence ischemic neuronal death. In vivo evidence supports the neuroprotective effects of overexpression of several anti-apoptotic Bcl-2 family members against ischemia-induced neuronal death [1,10,22]. Bcl2 homology domain 3 (BH3)-only proteins may be the proximal effectors of mitochondrial dysfunction via their ability to inactivate anti-apoptotic Bcl-2 family proteins and/or directly activate pro-apoptotic Bax. Among seven mammalian BH3-only proteins identified to date, in vivo roles in mediating ischemic brain injury are supported for Bid [16,26], Bad [19], Bim [14] and Noxa [8]. Puma (p53-upregulated mediator of apoptosis, also known as Bbc3) is a

∗ Corresponding author. Tel.: +353 1 402 2255; fax: +353 1 402 2447. E-mail address: [email protected] (J.H.M. Prehn). 0304-3940/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2009.01.019

recently identified potent BH3-only protein and p53 target gene [12]. In neurons, Puma is a transcriptional target of p53 following DNA damage [23] but Puma induction is p53-independent following endoplasmic reticulum stress [17]. Puma may also be a target gene of FoxO3a [27]. Puma is required for DNA damage-induced sympathetic neuronal death [25] and contributes to motoneuron death in models of amyotrophic lateral sclerosis [9]. Puma protein is upregulated following transient global cerebral ischemia [17] but Puma is neither induced nor required for neuronal death caused by N-methyl-d-aspartate toxicity in vitro or in vivo [2]. To more fully define the contribution of Puma to acute neuronal death we measured expression following transient focal cerebral ischemia in mice and investigated whether deletion of the puma gene confers protection in this model. Animal experiments were carried out under license from the Department of Health and Children (Ireland) and were in accordance with European Communities Council Directive (86/609/EEC). Procedures were reviewed and approved by the Research Ethics Committee of the Royal College of Surgeons in Ireland and all efforts were made to minimize animal use and discomfort. For analysis of puma expression, C57Bl/6 mice were used (Harlan UK Ltd., Oxon, England). Puma-deficient (puma−/− ) mice on a C57Bl/6 background were provided by Prof Andreas Strasser (WEHI, Melbourne, Australia) and bred and genotyped as described [24]. A group comprising both wildtype puma+/+ littermates and C57Bl/6 mice were used for comparison to puma−/− mice.

238

K. Kuroki et al. / Neuroscience Letters 451 (2009) 237–240

Male mice aged 9 and 10 weeks (20–24 g) were used in all studies. Induction of reversible middle cerebral artery (MCA) occlusion was performed using the monofilament suture method as described [4] with modifications. Briefly, mice were anesthetized with 5% isoflurane and maintained normothermic via a feedbackcontrolled heat blanket. A silicon-coated 8-0 nylon monofilament with rounded tip was introduced into the left internal carotid artery and advanced past the carotid artery bifurcation to occlude the MCA with laser Doppler flowmetry skull surface monitoring (Perimed UK Ltd., Bury St. Edmonds, England). After 90 min the suture was slowly withdrawn to allow reperfusion. Effective occlusion and subsequent re-canalisation was monitored by laser Doppler flowmetry in all mice. Non-ischemic control mice underwent the same surgical procedure but the filament was not advanced to occlude the vessel. Mice were euthanized 4–24 h later under deep barbiturate anesthesia and brains removed and processed for either puma expression analysis or calculation of infarct volume. At the time of sacrifice the plasticity of the posterior communicating artery was examined and graded in a subset of puma+/+ and puma−/− mice for the presence of anastomoses which influence ischemic lesions, as described [26]. Neurological deficit scores were assessed as described previously [16]. Briefly, the neurological function of mice was evaluated 90 min or 24 h after ischemia using a 5-point scale, as follows: Score 0, no deficit; Score 1, weakness of the contralateral forepaw; Score 2, circling; Score 3, loss of righting reflex; and Score 4, no motor activity. Infarct volume was assessed 24 h after ischemia using the triphenyltetrazolium chloride (TTC) method. Briefly, mouse brains were sectioned coronally at 1-mm intervals. Eight sections were immersed in 2,3,5-triphenyltetrazolium chloride (2%) (Sigma–Aldrich Ireland Ltd., Dublin, Ireland) at 37 ◦ C for 15 min, followed by fixing in 10% formalin for 15 min. The cortical, striatal and combined hemispheric infarct area in each section was calculated by subtracting the area of normal TTC-stained brain in the ipsilateral field from the matching contralateral area (NIH Image software). Infarct volume was then calculated by the infarct area multiplied by the section thickness and summed over the entire brain [18]. Real-time quantitative PCR was performed to detect transcriptional induction of puma, as previously described with modifications [9]. Total RNA was extracted from cerebral cortex within the MCA vascular territory 4, 8 and 24 h after ischemia or after 24 h in controls, using Trizol (Invitrogen, Paisley, UK). First-strand cDNA synthesis was performed according to the manufacturers’ instruction by using 2 ␮g of Moloney murine leukaemia virus reverse transcriptase (Invitrogen). cDNA synthesis was performed using Superscript II (Invitrogen,) reverse transcriptase with 2 ␮g of total RNA primed with 50 pmol random heximers. Quantitative real-time PCR was performed using the LightCycler 2.0 (Roche Products (Ireland) Ltd., CityWest, Ireland) and the QuantiTech SYBR green PCR kit (Qiagen Ltd.) [2]. Sense and antisense primers used were as follows: ATGGCCCGCGCACGCCAGG and CCGCCGCTCGTACTGCGCGTT for puma; AACTTTGGCATTGTGGAAGG and ACACATTGGGGGTAGGAACA for gapdh. The generation of specific PCR products was confirmed by melting curve analysis. The data were analyzed using LightCycler software, version 4.0, with all samples normalized to Glyceraldehyde 3-phosphate dehydrogenase (gapdh). For analysis of Puma protein expression 30 ␮g of whole cell lysate prepared from ipsilateral cerebral cortex of control or MCA occlusion mice was resolved on a 15% SDS-PAGE gel and transferred to nitrocellulose. Membranes were incubated with a rabbit polyclonal antibody to Puma (1:1000; ProSci, Alpha Technologies, Blessington Co. Wicklow, Ireland) or a mouse monoclonal antibody to Actin (Sigma, Tallaght, Dublin, Ireland). Immunoreactivity was detected with anti-mouse or anti-rabbit peroxidase-conjugated secondary antibodies (1:5000, Jackson Immuno Research, Newmar-

Fig. 1. Induction of Puma following transient focal cerebral ischemia in mice. (a and b) Graphs showing results of real-time quantitative PCR analysis of puma mRNA expression in the cortex 4–24 h following 90 min MCA occlusion with reperfusion. *p < 0.05 compared to control (Con). Data were normalized to gapdh levels and expressed relative to matched controls for n = 4–7 mice per group. (c) Western blot analysis (n = 1 per lane) of Puma expression in ipsilateral control (24 h) and ischemic cortex (4–24 h), confirming Puma protein induction at 8 and 24 h.

ket, UK) and the Immobilon Western chemiluminescence substrate (Millipore Co. Cork, Ireland) and imaged using a FujiFilm LAS-3000 imaging system (Fuji, Sheffield, UK). Data are presented as mean ± S.E.M. Puma mRNA data were analyzed using ANOVA followed by post hoc Fisher’s PLSD test. Infarct volumes were compared using unpaired Student’s t-test. Neurological deficit scores were compared using Mann–Whitney U-test. Significance was accepted at p < 0.05. Real-time quantitative PCR determined that cortical expression of puma mRNA was significantly increased 2.5 fold at 8 h following reperfusion after MCA occlusion in C57Bl/6 mice, returning toward baseline by 24 h (Fig. 1a). Expression of puma mRNA was not changed at any time point in the contralateral cortex (Fig. 1b). Western blot analysis determined that Puma protein levels were increased at 8 and 24 h following MCA occlusion in C57Bl/6 mice (Fig. 1c). Next, we examined ischemic infarction volumes in puma+/+ and puma−/− mice. There were no significant differences between genotypes for age (9 and 10 weeks) or weight (puma+/+ ; 21.7 ± 0.5 g versus puma−/− 22.6 ± 1.3 g) at the time of the experiment. We have previously reported that puma−/− mice display no overt neurodevelopmental abnormalities [2]. Here, we analyzed the posterior communicating artery and could find no significant differences in vascular anatomy between genotypes (data not shown). Twenty-four hours following 90 min MCA occlusion, puma+/+ mice displayed a large infarct as assessed by TTC staining encompassing the cortex and striatum within the vascular territory of the MCA (Fig. 2a–c). Infarction volumes for the cortex, striatum or hemisphere were not significantly different in puma−/− mice (Fig. 2b and c). Neurological deficit scores were also compared between genotypes 90 min after stroke and 24 h after reperfusion (Fig. 2d). There were no significant differences between puma+/+ and puma−/− mice for neurological deficits at either time point examined (Fig. 2d). The present report is the first demonstration that the BH3-only protein Puma is upregulated by focal cerebral ischemia in mice. However, our experiments revealed that deficiency in puma did not protect against either histological or neurological deficits induced

K. Kuroki et al. / Neuroscience Letters 451 (2009) 237–240

239

Fig. 2. Ischemic infarct size is not affected by puma deficiency. Representative TTC-stained brain slices (1 mm each) from (a) puma+/+ and (b) puma−/− mice 24 h after 90 min MCA occlusion. Note similarity in extent of damage (pale-colored tissue area) between genotypes at each level. (c) Graphs showing infarct volume measurements 24 h after focal cerebral ischemia for each genotype. No significant difference was found between groups. (d) Neurological deficit scores for each genotype. Score 0, no deficit; Score 1, weakness of the contralateral forepaw; Score 2, circling; Score 3, loss of righting reflex; and Score 4, no motor activity. No differences were found between genotypes at either assessment time. Data are from n = 6–12 mice per genotype.

by 90 min MCA occlusion in mice. These data suggest Puma may have late or weak effects on ischemic cell death in vivo implying functional redundancy among BH3-only proteins induced by experimental cerebral ischemia. These data potentially exclude Puma as a target of high interest for neuroprotection in stroke. Focal cerebral ischemia has been shown to activate several members of the BH3-only protein family, including Bid, Bim, Bad and Noxa, via p53, c-Jun N-terminal kinase and other pathways. The present data demonstrate that puma, a potent BH3-only member of the Bcl-2 family, is induced by transient focal cerebral ischemia in mice, complementing earlier results from our group in a rat model of transient global cerebral ischemia [17]. However, we found puma-deficient mice to be as susceptible as wildtype mice to tis-

sue damage and neurological deficits after 90 min MCA occlusion. This contrasts with the functional requirement of puma for sympathetic neuron and motoneuron death in vivo [9,25]. However, also in these models, cell death was delayed rather than prevented by puma deficiency. While we avoided potentially mitigating factors in our study design including age, weight and cerebrovascular development we cannot exclude subtle anatomical or physiological differences may have influenced our findings. Since only a 24 h time point was analyzed presently we cannot exclude an effect of puma deficiency on more delayed (e.g. 72 h) neuronal death or functional outcomes in this model. Last, it remains possible that Puma is important in models featuring shorter MCA occlusion times where the ischemia-driven apoptotic component may be more significant.

240

K. Kuroki et al. / Neuroscience Letters 451 (2009) 237–240

The lack of protection in puma-deficient mice was unexpected given its robust induction, known potency as a BH3-only protein, and transcriptional control lying downstream of three major ischemia-activated apoptosis signaling pathways (p53, FoxO3a and endoplasmic reticulum stress). This may derive partly from the temporal profile of puma induction and likely functional redundancy among the BH3-only proteins. Puma induction after focal ischemia was only significant at 8 h, a time point after mitochondrial release of apoptogenic substances including cytochrome c and caspase activation in vivo [6,15]. Thus, the temporal profile of Puma induction may render it functionally unimportant. Even if Puma contributed to the mechanics of the cell death process, several other BH3-only proteins are constitutively expressed at robust levels in normal brain and rapidly activated or induced within 4 h of focal ischemia, including Bid, Bim and Bad [6,16,19]. Knockout of bid, bad and bim has each been reported to have neuroprotective effects against cerebral ischemia [13,16,26]. Thus, our data are consistent with selective functional redundancy within the BH3-only family for neuronal death resulting from focal cerebral ischemia. Investigation of ischemic damage in double-knockouts of BH3-only proteins may be valuable to determine whether cooperative actions of Puma with other BH3-only proteins occur, as reported in other cell death systems [5]. The upstream transcriptional pathways underlying puma induction in the present model were not a focus of study. However, the finding that puma is induced in vivo by ischemia but not N-methyld-aspartate toxicity [2] suggests at least one Puma transcriptional pathway is not fully recapitulated in the N-methyl-d-aspartatealone model. We might speculate that endoplasmic stress is important for puma induction after ischemia in neurons, in line with earlier reports [17]. In summary, the present study provides in vivo evidence that focal cerebral ischemia results in transcription and translation of the BH3-only gene puma but its absence is not protective against ischemic damage. These data refine target selection for potential neuroprotective interventions for acute central nervous system insults such as stroke. Acknowledgements The authors thank Dr Eva Jimenez-Mateos for technical support and Prof Andreas Strasser and Prof Andreas Villunger for the gift of the puma-deficient mice. This work was supported by funding from Science Foundation Ireland (03/RP1/B344 and 04/IN3/B466), Health Research Board Ireland (RP/2005/24), IRCSET postdoctoral fellowship (to T.E.) and Marie Curie grant FP6-14499. References [1] G. Cao, W. Pei, H. Ge, Q. Liang, Y. Luo, F.R. Sharp, A. Lu, R. Ran, S.H. Graham, J. Chen, In vivo delivery of a Bcl-xL fusion protein containing the TAT protein transduction domain protects against ischemic brain injury and neuronal apoptosis, J. Neurosci. 22 (2002) 5423–5431. [2] C.G. Concannon, M.W. Ward, H.P. Bonner, K. Kuroki, L.P. Tuffy, C.T. Bonner, I. Woods, T. Engel, D.C. Henshall, J.H. Prehn, NMDA receptor-mediated excitotoxic neuronal apoptosis in vitro and in vivo occurs in an ER stress and PUMA independent manner, J. Neurochem. 105 (2008) 891–903. [3] R.C. Crumrine, A.L. Thomas, P.F. Morgan, Attenuation of p53 expression protects against focal ischemic damage in transgenic mice, J. Cereb. Blood Flow Metab. 14 (1994) 887–891. [4] C. Culmsee, C. Zhu, S. Landshamer, B. Becattini, E. Wagner, M. Pellecchia, K. Blomgren, N. Plesnila, Apoptosis-inducing factor triggered by poly(ADPribose) polymerase and Bid mediates neuronal cell death after oxygen-glucose deprivation and focal cerebral ischemia, J. Neurosci. 25 (2005) 10262– 10272.

[5] M. Erlacher, V. Labi, C. Manzl, G. Bock, A. Tzankov, G. Hacker, E. Michalak, A. Strasser, A. Villunger, Puma cooperates with Bim, the rate-limiting BH3-only protein in cell death during lymphocyte development, in apoptosis induction, J. Exp. Med. 203 (2006) 2939–2951. [6] Y. Gao, A.P. Signore, W. Yin, G. Cao, X.M. Yin, F. Sun, Y. Luo, S.H. Graham, J. Chen, Neuroprotection against focal ischemic brain injury by inhibition of cJun N-terminal kinase and attenuation of the mitochondrial apoptosis-signaling pathway, J. Cereb. Blood Flow Metab. 25 (2005) 694–712. [7] T. Hayashi, A. Saito, S. Okuno, M. Ferrand-Drake, R.L. Dodd, P.H. Chan, Oxidative injury to the endoplasmic reticulum in mouse brains after transient focal ischemia, Neurobiol. Dis. 15 (2004) 229–239. [8] I. Inta, S. Paxian, I. Maegele, W. Zhang, M. Pizzi, P. Spano, I. Sarnico, S. Muhammad, O. Herrmann, D. Inta, B. Baumann, H.C. Liou, R.M. Schmid, M. Schwaninger, Bim and Noxa are candidates to mediate the deleterious effect of the NF-kappa B subunit RelA in cerebral ischemia, J. Neurosci. 26 (2006) 12896–12903. [9] D. Kieran, I. Woods, A. Villunger, A. Strasser, J.H. Prehn, Deletion of the BH3only protein puma protects motoneurons from ER stress-induced apoptosis and delays motoneuron loss in ALS mice, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 20606–20611. [10] M.S. Lawrence, D.Y. Ho, G.H. Sun, G.K. Steinberg, R.M. Sapolsky, Overexpression of Bcl-2 with herpes simplex virus vectors protects CNS neurons against neurological insults in vitro and in vivo, J. Neurosci. 16 (1996) 486–496. [11] A.K.F. Liou, R.S. Clark, D.C. Henshall, X.M. Yin, J. Chen, To die or not to die for neurons in ischemia, traumatic brain injury and epilepsy: a review on the stress-activated signaling pathways and apoptotic pathways, Prog. Neurobiol. 69 (2003) 103–142. [12] K. Nakano, K.H. Vousden, PUMA, a novel proapoptotic gene, is induced by p53, Mol. Cell 7 (2001) 683–694. [13] J.M. Ness, C.A. Harvey, A. Strasser, P. Bouillet, B.J. Klocke, K.A. Roth, Selective involvement of BH3-only Bcl-2 family members Bim and Bad in neonatal hypoxia-ischemia, Brain Res. 1099 (2006) 150–159. [14] S. Okuno, A. Saito, T. Hayashi, P.H. Chan, The c-Jun N-terminal protein kinase signaling pathway mediates Bax activation and subsequent neuronal apoptosis through interaction with Bim after transient focal cerebral ischemia, J. Neurosci. 24 (2004) 7879–7887. [15] N. Plesnila, C. Zhu, C. Culmsee, M. Groger, M.A. Moskowitz, K. Blomgren, Nuclear translocation of apoptosis-inducing factor after focal cerebral ischemia, J. Cereb. Blood Flow Metab. 24 (2004) 458–466. [16] N. Plesnila, S. Zinkel, D.A. Le, S. Amin-Hanjani, Y. Wu, J. Qiu, A. Chiarugi, S.S. Thomas, D.S. Kohane, S.J. Korsmeyer, M.A. Moskowitz, BID mediates neuronal cell death after oxygen/glucose deprivation and focal cerebral ischemia, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 15318–15323. [17] C. Reimertz, D. Kogel, A. Rami, T. Chittenden, J.H. Prehn, Gene expression during ER stress-induced apoptosis in neurons: induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway, J. Cell Biol. 162 (2003) 587–597. [18] H.L. Rosenzweig, M. Minami, N.S. Lessov, S.C. Coste, S.L. Stevens, D.C. Henshall, R. Meller, R.P. Simon, M.P. Stenzel-Poore, Endotoxin preconditioning protects against the cytotoxic effects of TNFalpha after stroke: a novel role for TNFalpha in LPS-ischemic tolerance, J. Cereb. Blood Flow Metab. 27 (2007) 1663–1674. [19] A. Saito, T. Hayashi, S. Okuno, M. Ferrand-Drake, P.H. Chan, Overexpression of copper/zinc superoxide dismutase in transgenic mice protects against neuronal cell death after transient focal ischemia by blocking activation of the Bad cell death signaling pathway, J. Neurosci. 23 (2003) 1710–1718. [20] M. Shibata, H. Hattori, T. Sasaki, J. Gotoh, J. Hamada, Y. Fukuuchi, Activation of caspase-12 by endoplasmic reticulum stress induced by transient middle cerebral artery occlusion in mice, Neuroscience 118 (2003) 491–499. [21] N. Shioda, T. Ishigami, F. Han, S. Moriguchi, M. Shibuya, Y. Iwabuchi, K. Fukunaga, Activation of phosphatidylinositol 3-kinase/protein kinase B pathway by a vanadyl compound mediates its neuroprotective effect in mouse brain ischemia, Neuroscience 148 (2007) 221–229. [22] Y. Sun, K. Jin, K.R. Clark, A. Peel, X.O. Mao, Q. Chang, R.P. Simon, D.A. Greenberg, Adeno-associated virus-mediated delivery of BCL-w gene improves outcome after transient focal cerebral ischemia, Gene Ther. 10 (2003) 115–122. [23] T. Uo, Y. Kinoshita, R.S. Morrison, Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons, J. Neurosci. 27 (2007) 12198–12210. [24] A. Villunger, E.M. Michalak, L. Coultas, F. Mullauer, G. Bock, M.J. Ausserlechner, J.M. Adams, A. Strasser, p53- and drug-induced apoptotic responses mediated by BH3-only proteins puma and noxa, Science 302 (2003) 1036–1038. [25] A. Wyttenbach, A.M. Tolkovsky, The BH3-only protein Puma is both necessary and sufficient for neuronal apoptosis induced by DNA damage in sympathetic neurons, J. Neurochem. 96 (2006) 1213–1226. [26] X.M. Yin, Y. Luo, G. Cao, L. Bai, W. Pei, D.K. Kuharsky, J. Chen, Bid-mediated mitochondrial pathway is critical to ischemic neuronal apoptosis and focal cerebral ischemia, J. Biol. Chem. 277 (2002) 42074–42081. [27] H. You, M. Pellegrini, K. Tsuchihara, K. Yamamoto, G. Hacker, M. Erlacher, A. Villunger, T.W. Mak, FOXO3a-dependent regulation of Puma in response to cytokine/growth factor withdrawal, J. Exp. Med. 203 (2006) 1657–1663.