FEMS Microbiology Letters 173 (1999) 297^302

Co-existence of clpB and clpC in the Bacillaceae Olivier Namy 1 , Micheéle Mock, Agneés Fouet * Toxines et Pathogeènie Bacteèriennes (CNRS URA 1858), Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France Received 8 September 1998; received in revised form 10 October 1998; accepted 15 January 1999

Abstract The gene encoding ClpC in Bacillus anthracis was amplified from the chromosome by polymerase chain reaction using degenerate oligonucleotide primers. These primers also amplified a second DNA fragment identified as a clpB homolog. Both genes were suggested to be functional. Contrary to Bacillus subtilis which possesses clpC but not clpB, many Bacillus species were found to harbor both clpC and clpB. We also found that Clostridium strains could possess clpB, clpC, or both. All the Gram-negative strains tested had clpB only. z 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Bacillus anthracis; Bacillaceae; Clp protease

1. Introduction Microorganisms have developed strategies to respond rapidly to environmental stress or changes. The adaptation process involves proteolytic and chaperone activities. ClpAP is a protease in Escherichia coli. The ClpA ATPase activates the ClpP protein for proteolysis [1,2]. The Clp ATPases belong to the Clp/Hsp100 family of molecular chaperones [3]. ClpB and ClpC have regions of sequence in common with ClpA. These molecules are classi¢ed according to size, with ClpB having the largest molecular mass (reviewed in [2,4,5]). ClpB is a heat shock protein, * Corresponding author. Tel.: +33 (1) 4568 8654; Fax: +33 (1) 4568 8954; E-mail: [email protected] 1 Present address: Institut de Geèneètique et Microbiologie, CNRS URA 2225, Laboratoire de Geèneètique Moleèculaire de la Traduction, Universiteè Paris-Sud, Baêt. 400, 91405 Orsay Cedex, France.

and the ClpB of E. coli has been thoroughly characterized. It seems to be absent in Bacillus subtilis, in which ClpC, sometimes described as the alternative Gram-positive heat-inducible Clp protein, has been found [6^8]. ClpC plays a key role in the stationary phase regulatory network in B. subtilis [6]. ClpC has been identi¢ed in Listeria monocytogenes, which is required for the stress tolerance and survival in vivo of this pathogenic bacterium [9,10]. Bacillus anthracis, the etiological agent of anthrax, a mammalian disease, is usually regarded as the only pathogen belonging to the Bacillus genus [11]. B. anthracis has to respond to various stresses such as oxidative shock, after entering the host. Later in the disease the bacterium encounters growth-limiting conditions and enters a stationary phase. We therefore aimed to isolate the clpC gene so that we could analyze the function of ClpC in B. anthracis. We found that B. anthracis contained not only clpC but also clpB, both genes being functional. The pres-

0378-1097 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 0 8 0 - 4

FEMSLE 8679 25-3-99

298

O. Namy et al. / FEMS Microbiology Letters 173 (1999) 297^302

ence of both these clp genes in the same species has only been described for Synechococcus sp. [8,12]. So, we investigated whether both genes occur together in other members of the Bacillaceae family, or whether, as described in B. subtilis, clpC was exclusive of clpB.

2. Materials and methods 2.1. Bacterial strains, vectors and culture media The strains used were: B. anthracis 9131 and RBA2 [13], B. subtilis 168, Bacillus thuringiensis 4045, Bacillus sphaericus ATCC 14577, B. sphaericus 1593, Listeria monocytogenes LO28, Clostridium dif¢cile VPI 10463, Clostridium perfringens CPN 50, Clostridium sordelli NCIB, E. coli K12, Yersinia pestis col 17, and Neisseria meningitidis clone 12. E. coli TG1 [14] was used as a host for pUC19. E. coli strain HB101 harboring pRK24 T [15] was used for mating experiments. The vector pATvS28 was constructed by digesting pATv28 by XmnI and relegating it, thus deleting the Gram-positive origin of replication ([16] and J.-C. Sirard, personal communication). E. coli was grown in L broth or on L agar plates [17]. The Bacillaceae were grown in brain heart infusion (Difco Laboratories) medium or on brain heart infusion agar plates. Antibiotics were used in the following concentrations: ampicillin, 100 Wg ml31 for E. coli; and kanamycin, 40 Wg ml31 , spectinomycin 60 Wg ml31 , for both E. coli and B. anthracis.

DNA, the polymerase was added after an initial step of 5 min at 99.9³C. Sequences were determined either from PCR products, or from double-stranded DNA after cloning the fragments in pUC19 [19] by the dideoxy chain-termination procedure [20] using Sequenase kits (Amersham/USB) or the Prism AmpliTaq Dye Primer sequencing kit (Applied Biosystems) with an ABI PRISM 373A sequencer. Nucleotide and deduced amino acid sequences were analyzed using the Wisconsin Package (Genetics Computer Group Inc.). 2.3. Disruption of clpB and clpC genes, and transcriptional fusions between these genes and bgaB Recombinant suicide plasmid were transferred from E. coli to B. anthracis by a heterogramic conjugation procedure [15]. Allelic exchange was carried out as described previously [21] using either the kanamycin- or the spectinomycin-resistance cassette ([22,23] and Trieu-Cuot, personal communication) (Fig. 1). The clpB gene was disrupted with pB543K which was constructed as follows (Fig. 1). The bgaB gene,

2.2. DNA manipulation, ampli¢cation and sequencing Bacillaceae chromosomal DNA was extracted as described by Fouet and Sonenshein [18]. The degenerate oligonucleotides used were Clp220 (GGI GT(GAT) GGI AA(AG) AC(GAT) GC(GAT) AT(ATC) GC(GAT) GA(AG) GG) and Clp566 ((CT)TC IGT (CT)TT (ATC)CC (ATC)AC (ATC)CC (ATC)GT IGG (ATC)CC) (and see Section 3). PCR was carried out as follows: 10 cycles of 30 s at 94³C, 45 s at 47³C, 1 min at 72³C, followed by 10 cycles of 30 s at 94³C, 45 s at 53³C, 1 min at 72³C and 10 cycles of 30 s at 94³C, 45 s at 55³C, 1 min at 72³C, with a ¢nal extension for 5 min at 72³C. When bacterial colonies were used rather than

Fig. 1. Schematic representation of the plasmids constructed in this work. The vector for pB543K is pATvS28 and that for pC113S is pAT113. SpcR , spectinomycin-resistance cassette ; KanR , kanamycin-resistance cassette. The beginning of the primers used to amplify the sequences are represented by the arrowheads, the numbers indicating the distance between the nucleotide at the 5P end and the ATG codon of the given gene. PclpC indicates that the corresponding DNA fragment ends 20 nucleotides upstream from the clpC ATG codon. The long arrows show the direction of transcription of clpB, clpC and bgaB. The restriction sites used are represented; Sm, SmaI; Ec, Ecl136II; RI, EcoRI; St, StuI.

FEMSLE 8679 25-3-99

O. Namy et al. / FEMS Microbiology Letters 173 (1999) 297^302

299

Fig. 2. Products of PCR ampli¢cation reactions with degenerate clp-speci¢c primers. One tenth of each PCR reaction carried out on colonies or DNAs was loaded onto a 1.5% or 1% agarose gel. The DNA ladder (size marker) from Boehringer was loaded (lane 1). A: Bacillus species amplicons ; lane 2, B. subtilis 168; 3, B. anthracis RBA2 ; 4, B. thuringiensis 4045; 5, L. monocytogenes LO28; 6, B. sphaericus ATCC 14577; 7, B. sphaericus 1593. B: Clostridium species amplicons; lane 2, C. di¤cile VPI 10463; 3, C. perfringens CPN 50; 4, C. sordelli NCIB. C: Gram-negative bacteria amplicons; lane 2, E. coli K12; 3, Y. pestis col 17 ; 4, N. meningitidis clone 12.

encoding a thermoresistant L-galactosidase, was isolated by digesting pDL [24] by SmaI and Ecl136II and cloned in pATvS28 similarly digested, giving rise to pATvbgaB. A DNA fragment harboring sequences from nucleotide 3448 (GGGAAGGAGAATGGAAATGGGACAAAATC) to +100 (GAGATACCGCTAAAGATTGGGCAC), with respect to the ATG codon of the clpB gene, was PCR ampli¢ed and cloned in the SmaI site of pATvbgaB, upstream of the bgaB gene, in the same orientation of transcription giving rise to pB54. To construct pB543, the 964 (CTCATCGATGCAACAAGTATTAGCAGAAGAACCAAC) to 1561 (TTGGATCCAGCAATCTCTTCTTCACTTACTTCC) nt sequence was similarly ampli¢ed and cloned downstream of bgaB in the Ecl136II site of pB54. The oligonucleotide starting at position 964 recreates an Ecl136II site when cloned in that site. The kanamycin resistance cassette was cloned in the Ecl136II

site. Thus pB543K also harbors a transcriptional fusion between clpB and bgaB genes followed by a selectable marker and the 3P part of clpB. An equivalent construction was carried out for clpC, giving rise to pC113S (Fig. 1). The SmaIEcl136II bgaB fragment from pDL was cloned in the SmaI site of pUC19 (pB5). pB5C5 was then constructed by ligating into the SmaI site of pB5 the PCR ampli¢ed DNA fragment 3791 (AAGAATTCAGGAACGGAATATGGAGCATGTCTCTTG) to 320 (AACATCATAGAAATCGCCTCCTACTTGC), with respect to the clpC ATG codon. clpC and bgaB are in the same transcription orientation. To construct pC5S, the spectinomycin cassette was inserted downstream from bgaB in the Ecl136II site. The digestion of pC5S by StuI which is located in the spectinomycin cassette, outside the ORF, followed by the insertion of the 1497 (TTATTAAACTTAGAATCCATCCTTCACG) to 2050 (TCATC-

FEMSLE 8679 25-3-99

300

O. Namy et al. / FEMS Microbiology Letters 173 (1999) 297^302

CATTACTTTACCTTTCATATCC) nt clpC PCR ampli¢ed sequence gave rise to pC5SC3. The EcoRI DNA fragment of pC3SC5, harboring the transcriptional fusion followed by a selectable marker and the 3P region of clpC, was subcloned in pAT113 [25], resulting in pC113S.

3. Results and discussion 3.1. B. anthracis possesses both clpC and clpB To amplify B. anthracis clpC from the chromosome, by PCR, we compared the amino acid sequences of ClpC from B. subtilis [6] and L. monocytogenes [9]. The ATP-binding motifs are well conserved in all Clp ATPases and two sequences, identical in the B. subtilis and L. monocytogenes ClpCs, were identi¢ed in the A boxes of each ATP-binding motif, between residues 211^220 and 545^554 (B. subtilis numbering). Degenerate oligonucleotides (Clp220 and Clp566) were designed from these sequences. When PCR was performed with the B. anthracis RBA2 chromosome, two fragments were obtained: one with the expected size of approximately 1 kb, and another about 150 bp larger (Fig. 2A, lane 3). The same experiment with B. subtilis 168 DNA generated a single fragment, of about 1 kb in size (Fig.

2A, lane 2). This fragment was partially sequenced and its sequence was completely identical to that of the published B. subtilis clpC sequence [6]. The spacer between the two highly conserved nucleotide-binding motifs is 60^70 residues in ClpC proteins and 120^130 residues in ClpB proteins, which suggested that the larger B. anthracis DNA fragment encoded the ClpB ATPase. We therefore determined the DNA sequence of the two fragments (accession numbers AJ224158 and AJ224159 for the 1-kb and the 1.15-kb fragments, respectively). Reverse PCR was performed to isolate the chromosomal DNA encompassing the binding sites of the initial primers, and to thus determine the hybridizing sequences. Data bases and the completed SubtiList [26,27], were searched with the deduced amino acid sequences. We found that the peptide encoded by the 1-kb fragment was highly similar to the B. subtilis ClpC (SWP37571) (90.7% identity over a 334-amino acid overlap) and that encoded by the 1.15-kb fragment was highly similar to the Synechocystis ClpB (SWP53533) [8] (63.4% identity over a 410-amino acid overlap) (Fig. 3). We compared the B. anthracis Clp homologs and found that their level of sequence identity di¡ered in di¡erent regions. The sequences were 62.5% identical for the ¢rst conserved nucleotide binding motif and 69% for the second. The spacer regions between

Fig. 3. Schematic representation of Clp sequence comparison. The complete published B. subtilis ClpC (SWP37571) and Synechocystis ClpB (SWP53533) sequences are represented and the number of residues given. The determined sequences of the initial amplicons of B. anthracis ClpC and ClpB homologs are represented. The hatched boxes represent the conserved nucleotide binding domains 1 and 2; and the empty boxes, the spacers, with the number of amino acid residues shown. The black boxes in the B. subtilis sequence mark the A boxes, and the arrows above show the binding sites and orientation of the primers. The numbers between the dashed lines indicate the percentage identity between the highlighted regions.

FEMSLE 8679 25-3-99

O. Namy et al. / FEMS Microbiology Letters 173 (1999) 297^302

these two blocks was 61 residues long for ClpC and 125 residues long for ClpB (Fig. 3). No sequence encoding ClpB was detected by PCR ampli¢cation or by sequence analysis of the complete B. subtilis chromosome, demonstrating the speci¢city of its presence on the B. anthracis chromosome. 3.2. B. anthracis clpB and clpC are functional The only other bacterium so far where ClpC and ClpB have been characterized is Synechococcus. In this cyanobacterium, ClpB is a heat shock protein whereas the synthesis of ClpC increases under conditions of rapid growth. Transcriptional fusions were constructed to assay the regulation of synthesis of ClpB (pB543K) and ClpC (pC113S) in B. anthracis (Fig. 1). CLB10 was obtained by integrating by homologous recombination the insert of pB543K in the chromosome of strain 9131, selecting for kanamycin resistance an assaying the spectinomycin sensitivity. L-Galactosidase expression was induced in given growth conditions, thus indicating that clpB is expressed in B. anthracis. A similar mating experiment between E. coli harboring pC113S and B. anthracis 9131 was carried out four times unsuccessfully, whereas these genetic exchanges are routinely done in our laboratory. This strongly suggested that clpC, or a gene downstream, is essential for B. anthracis growth. This implied that clpC is transcribed in B. anthracis and thus functional. An identical conclusion was proposed for the same reason by Clarke and Eriksson, for the Synechococcus clpC gene [12]. 3.3. The presence of clpC and/or clpB in other bacteria Our data and the analysis of the complete B. subtilis sequence [26] indicated that B. subtilis contained only clpC, whereas B. anthracis possessed both clpC and clpB, so we carried out a larger survey of the distribution of clpC and clpB among bacteria. Various DNAs, or colonies, from Gram-positive and Gram-negative bacteria were used as templates for PCR ampli¢cation with the primers (Fig. 2). Two fragments of 1 kb and 1.15 kb in size were detected, for B. anthracis, B. thuringiensis 4045, L. monocytogenes LO28 and B. sphaericus ATCC 14577 (Fig. 2A, lanes 3^6). The 1-kb and 1.15-kb DNA fragments

301

obtained by ampli¢cation from the L. monocytogenes LO28 chromosome were partially sequenced, showing that they encoded the L. monocytogenes LO28 ClpC (1-kb fragment) [9] and a ClpB homolog (1.15-kb fragment). Both bands were also detected in the PCR products for the B. sphaericus 1593 strain, although the 1.15-kb band was very faint (Fig. 2A, lane 7). Our data suggest that B. subtilis is exceptional among the Bacillus strains tested, and that the species of the Bacillus genus usually have both genes (Fig. 2A). However, this does not seem to be the case for the whole of the Bacillaceae family, because Clostridium strains had all the possible gene combinations. Some had only a 1-kb fragment (C. di¤cile VPI 10463), or only a 1.15-kb fragment (C. sordelli NCIB) and some both (C. perfringens CPN 50) (Fig. 2B). Only clpB was detected in the Gramnegative bacteria tested (E. coli K12, Y. pestis col 17, N. meningitidis clone 12) (Fig. 2C). The bacterial genomic data bases were also searched for the presence of ClpB and ClpC. The occurrence of both proteins is only described for Clostridium acetobutilicum, reinforcing our conclusions. Thus, our data suggest that ClpC is not an alternative to ClpB in Gram-positive bacteria, or Bacillus spp., and that there is no obvious explanation for the distribution of clpB and clpC genes in the Bacillaceae.

Acknowledgments The authors wish to thank E. Carniel, A. Delecluse, B. Dupuy, S. Mesnage, T. Msadek, J.-C. Sirard, and M.K. Taha for providing bacterial strains or DNAs. O.N. was a DGA fellow. This work was supported by DRET 94/118.

References [1] Gottesman, S. (1996) Proteases and their targets in Escherichia coli. Annu. Rev. Genet. 30, 465^506. [2] Gottesman, S., Wickner, S. and Maurizi, M.R. (1997) Protein quality control: triage by chaperones and proteases. Genes Dev. 11, 815^823. [3] Gottesman, S. and Maurizi, M.R. (1992) Regulation by proteolysis : Energy-dependent proteases and their targets. Microbiol. Rev. 56, 592^621.

FEMSLE 8679 25-3-99

302

O. Namy et al. / FEMS Microbiology Letters 173 (1999) 297^302

[4] Squires, C. and Squires, C.L. (1992) The Clp proteins: Proteolysis regulators or molecular chaperones ? J. Bacteriol. 174, 1081^1085. [5] Wawrzynow, A., Banecki, B. and Zylicz, M. (1996) The Clp ATPases de¢ne a novel class of molecular chaperones. Mol. Microbiol. 21, 895^899. [6] Msadek, T., Kunst, F. and Rapoport, G. (1994) MecB of Bacillus subtilis, a member of the ClpC ATPase family, is a pleiotropic regulator controlling competence gene expression and growth at high temperature. Proc. Natl. Acad. Sci. USA 91, 5788^5792. [7] Kruger, S., Gertz, S. and Hecker, M. (1996) Transcriptional analysis of bgIPH expression in Bacillus subtilis: Evidence for two distinct pathways mediating carbon catabolite repression. J. Bacteriol. 178, 2637^2644. [8] Eriksson, M.-J. and Clarke, A.K. (1996) The heat shock protein ClpB mediates the development of thermotolerance in the cyanobacterium Synechococcus sp. strain PCC 7942. J. Bacteriol. 178, 4839-4846. [9] Rouquette, C., Ripio, M.-T., Pellegrini, E., Bolla, J.-M., Tasco, R.I., Vasquez-Boland, J.-A. and Berche, P. (1996) Identi¢cation of a ClpC ATPase required for stress tolerance and in vivo survival of Listeria monocytogenes. Mol. Microbiol. 21, 977^987. [10] Rouquette, C., de Chastellier, C., Nair, S. and Berche, P. (1998) The cplc ATPase of Listeria monocytogenes is a general stress protein required for virulence and promoting early bacterial escape from the phagosome of macrophages. Mol. Microbiol. 27, 1235^1245. [11] Thorne, C.B. (1993) Bacillus anthracis. In: Bacillus subtilis and Other Gram-positive Bacteria (Sonenshein, A.L. and Losick, R., Eds.), pp. 113^124. American Society for Microbiology, Washington, DC. [12] Clarke, A.K. and Eriksson, M.-J. (1996) The cyanobacterium Synechococcus sp. PCC7942 possesses a close homologue to the chloroplast ClpC protein of higher plants. Plant Mol. Biol. 31, 721^730. [13] Etienne-Toumelin, I., Sirard, J.-C., Du£ot, E., Mock, M. and Fouet, A. (1995) Characterization of the Bacillus anthracis Slayer : cloning and sequencing of the structural gene. J. Bacteriol. 177, 614^620. [14] Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

[15] Trieu-Cuot, P., Carlier, C., Martin, P. and Courvalin, P. (1987) Plasmid transfer by conjugation from Escherichia coli to Gram-positive bacteria. FEMS Microbiol. Lett. 48, 289^ 294. [16] Fouet, A., Sirard, J.-C. and Mock, M. (1994) Bacillus anthracis pXO1 virulence plasmid encodes a type 1 DNA topoisomerase. Mol. Microbiol. 11, 471^479. [17] Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. [18] Fouet, A. and Sonenshein, A.L. (1990) A target for carbon source-dependent negative regulation of the citB promoter of Bacillus subtilis. J. Bacteriol. 172, 835^844. [19] Vieira, J. and Messing, J. (1991) New pUC-derived cloning vectors with di¡erent selectable markers and DNA replications origins. Gene 100, 189. [20] Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463^5467. [21] Pezard, C., Berche, P. and Mock, M. (1991) Contribution of individual toxin components to virulence of Bacillus anthracis. Infect. Immun. 59, 3472^3477. [22] Trieu-Cuot, P. and Courvalin, P. (1983) Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3P,5Qaminoglycoside phosphotransferase type III. Gene 23, 331^ 341. [23] Murphy, E. (1985) Nucleotide sequence of a spectinomycin adenyltransferase AAD(9) determinant from Staphylococcus aureus and its relationship to AAD(3Q)(9). Mol. Gen. Genet. 200, 33^39. [24] Yuan, G. and Wong, S.-L. (1995) Regulation of groE expression in Bacillus subtilis: the involvement of the sA -like promoter and the roles of the inverted repeat sequences (CIRCE). J. Bacteriol. 177, 5427^5433. [25] Trieu-Cuot, P., Carlier, C., Poyart-Salmeron, C. and Courvalin, P. (1991) An integrative vector exploiting the transposition properties of Tn1545 for insertional mutagenesis and cloning of genes from Gram-positive bacteria. Gene 106, 21^27. [26] Kunst, F. et al. (1997) The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249^ 256. [27] Moszer, I., Glaser, P. and Danchin, A. (1995) SubtiList: a relational database for the Bacillus subtilis genome. Microbiology 141, 261^268

FEMSLE 8679 25-3-99