Molecular Ecology Notes (2004) 4, 426– 428

doi: 10.1111/j.1471-8286.2004.00672.x

PRIMER NOTE Blackwell Publishing, Ltd.

Characterization of eight polymorphic microsatellites in the shrew Crocidura suaveolens and its application to the study of insular populations of the French Atlantic coast C L A I R . E . C A L M E T ,* J O S I E L A M B O U R D I È R E ,* J A W A D A B D E L K R I M ,*† M I C H E L P A S C A L † and S A R A H S A M A D I * *UMR 7138 P6-IRD-MNHN-CNRS (UR IRD 148), Département Systématique et Evolution, Service de systématique moléculaire, Muséum National d’Histoire Naturelle, 43 rue Cuvier, 75005 Paris, France, †Equipe ‘Gestion des populations invasives’, Station SCRIBE, Centre INRA de Rennes, Campus de Beaulieu, F. 35 042 Rennes cedex, France

Abstract We developed eight polymorphic microsatellite loci to study the natural populations of Crocidura suaveolens, the lesser white-toothed shrew. These loci are used in the study of insular populations of the French Atlantic coast where these shrews exhibit gigantism features that suggest an insular syndrome. These populations were threatened by the invasion of the rat Rattus norvegicus and the eradication of this alien pest in some islands was followed by a demographic expansion of the shrew populations. These first genetic results suggest that the shrew populations in the three studied islands are very differentiated. Keywords: Crocidura suaveolens, insularity, invasion, microsatellites Received 4 February 2004; revision received 22 March 2004; accepted 22 March 2004

Crocidura suaveolens, the lesser white-toothed shrew, has a large distribution that encompasses the area between Spain and Korea and includes Japan (Wilson & Reeder 1993; Libois et al. 1999). This shrew invaded the northern two-thirds of France during the Holocene. It was suggested that in the western part of France, C. russula replaced C. suaveolens in most places (Cosson 1998). At present, C. suaveolens is scarce on the French Atlantic coast, except on islands, and its distribution is patchy. Moreover, insular populations, either from Corsica (Fons 1984) or from the Atlantic and Channel Islands (Cosson et al. 1996), exhibit gigantism features that suggest an insular syndrome. However, the scarcity of its remains prevents the determination of whether C. suaveolens reached the Atlantic and Channel coasts before or after the islands of this area were split from the continent. The brown rat, Rattus norvegicus, invaded France, and many other western European countries, during the 18th century. Its introduction on French Atlantic and Channel Islands threatened the shrew populations. Attempts at eradication of the alien rat populations on different islands were followed by a demographic explosion of shrew populations (Pascal et al. 1998). Molecular markers are Correspondence: Sarah Samadi. Fax: number: 33 140 79 38 44; E-mail: [email protected]

available for R. norvegicus, which is the common laboratory rat (Jacob 1995), and have already been used to analyse the rat invasion of French islands off Brittany (Calmet et al. 2001). To infer the past and present demography of C. suaveolens and its relations with the invasion history of R. norvegicus we developed new microsatellites markers. Microsatellite isolation and characterization followed a protocol developed by Estoup and Turgeon (1996) (see http://www.inapg.inra.fr/dsa/microsat/microsat.htm). Briefly, a genomic library for C. suaveolens was constructed using Bsp143I-digested genomic DNA; 400–900 base pair fragments were selected and ligated to BamHI-digested pUC 18 vector (Amersham) and cloned in Escherichia coli Solopack Gold super-competent cells (Stratagene). Synthetic oligonucleotides (TC)10, (TG)10, CT(ATCT)6, and (TGTA)6TG, labelled with [γ-33P]-dATP were used to screen ∼1400 recombinant colonies. About 105 positive clones were obtained and 26 were sequenced on a CEQ2000XL sequencer (Beckman/ Coulter) using dye-terminator chemistry. Eight primer pairs were designed using primer3 (Rozen & Skaletsky 1998). Polymerase chain reaction (PCR) mixtures (10 µL final volume) contained approximately 2 ng template DNA, 0.2 mm dNTP, 0.25 µm R-Primer, 0.25 µm L-Primer fluorescently labelled with one of 6-FAM, VIC, NED, PET (Applied Biosystems), 10 mm Tris–HCl (pH 9), 50 mm KCl, © 2004 Blackwell Publishing Ltd

P R I M E R N O T E 427 Table 1 Characterization of Crocidura suaveolens microsatellites

Locus

Primer sequence (5′– 3′)

CS25

F: TGGGTCCAGGGAGATTATTG R: GAGCAGCAGGTAGGGTATTTG F: CAAACACTTTCACAAAGCAGAG R: GAGATAGCAGCCTAAATGCAAG F: TCCTTATCAGAGAGACCATGTAGG R: GCCATTTTATATCAGGTCAGTGG F: AGGCAGAGGCTGTGTTAAGG R: TGTGACAGAATAAACCCCAGAC F: TCCTGAAATGCCAAAAGGAC R: TGAATGTCCCTCGTTTTCTTC F: GAGGTTCGCGTATGTGCTG R: CTGCTGTGTTGGTCTTGCTG F: TCTCCCAATTTCCAAGTACCC R: TCAGGGGCAACTTCTCTGAC F: GTCACAGGACATGGGATGG R: CTGCAATTCCCCACATCAG

CS38-2 CS40 CS43 CS50 CS57 CS71 CS73

Repeat motif

PCR conditions*

GenBank accession no.

(GT)16

55/30

AY531118

(CT)36TT(CT)5

55/30

AY531119

(GT)11

53/35

AY531120

(GT)7GATT(GA)20

57/30

AY531121

(GA)26

55/30

AY531122

(TG)14CA(TG)5

55/30

AY531123

(GT)22

55/30

AY531124

(GT)21

55/30

AY531125

*Annealing temperature (°C)/number of cycles. Table 2 Microsatellite polymorphism detected for three populations of Crocidura suaveolens on islands off Brittany Locus Island

Year

Beniguet

2000

Bono

1999

Rouzic

1999

Total

Size (bp) n A HE HO Size (bp) n A HE HO Size (bp) n A HE HO Size (bp) A Mean HE Mean HO

25

38 –2

40

43

50

57

71

73

212 20 1 — — 218 –228 20 3 0.48 0.50 220 10 1 — — 212 –228 4 0.16 0.17

178 –182 20 3 0.22 0.25 176 –180 20 2 0.32 0.30 206 –210 20 3 0.55 0.60 176 –210 7 0.36 0.38

249–251 20 2 0.18 0.20 233 20 1 — — 233 20 1 — — 233–251 3 0.06 0.07

309–311 19 2 0.05 0.05 311–321 17 3 0.37 0.47 321–323 18 2 0.05 0.06 309–323 5 0.16 0.19

181–187 20 4 0.70 0.50 189–191 20 2 0.37 0.40 189–191 20 2 0.32 0.40 181–191 6 0.46 0.43

162 20 1 — — 161 20 1 — — 164–166 20 2 0.32 0.40 162–166 3 0.11 0.13

300–318 19 4 0.61 0.42 292 18 1 — — 294 14 1 — — 292–318 6 0.20 0.14

190 –194 20 3 0.59 0.70 174 –178 20 2 0.40 0.35 178 –180 20 2 0.22 0.25 174 –194 6 0.40 0.43

n, number of individuals genotyped; A, number of alleles: HO, observed heterozygosity: HE, expected heterozygosity.

0.1% Triton®X−100, 1 U Taq DNA polymerase (Qbiogene), and 1.5 mm MgCl2. Cycling was performed in an MWG AG thermal cycler (Biotech) under the following conditions: an initial denaturation step at 95 °C for 5 min followed by five cycles of 1 min at 95 °C, 30 s at the annealing temperature and 1 min at 72 °C, then 25 – 30 cycles of 30 s at 94 °C, 30 s at the annealing temperature and 30 s at 72 °C and the final elongation step of 20 min at 72 °C; annealing temperature and cycle number depend on loci (Table 1). © 2004 Blackwell Publishing Ltd, Molecular Ecology Notes, 4, 426–428

PCR products were resolved on a 310 DNA sequencer and analysed using genescan software (Applied Biosystems). Eight microsatellite loci gave repeatable and scorable polymorphic patterns. Allelic variation was assayed in 60 individuals collected on three French islands off Brittany (20 from each population). The total number of alleles per locus varied from three to seven. Allele frequencies at each locus and for each population and heterozygosities (Table 2) were estimated using genetix (Belkhir et al. 2000). Deviations

428 P R I M E R N O T E from Hardy–Weinberg expectations were computed using genepop software version 3.3 (Raymond & Rousset 1995) Mean observed heterozygosities at each microsatellite locus ranged from 0.07 to 0.43. These first polymorphism results on three islands revealed that islands are differentiated from one another at least at two loci. The islands of Bono and Rouzic, which are in the Sept-Iles archipelago, present more alleles in common than each with Beniguet (in the Iroise sea). None of these loci showed significant departure from Hardy– Weinberg expectations in any of the populations studied. Given their level of polymorphism, these microsatellites will be useful in the study and comparison of the genetic structure of populations on the islands off Brittany and in inferring past and present demography of populations.

Acknowledgements This work was supported financially by the Musée National d’Histoire Naturelle and the Institut National de la Recherche Agronomique. Jawad Abdelkrim received a PhD fellowship from the Conservatoire National du Littoral et des Espaces Lacustres.

References Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (2000) GENETIX 4 02, Logiciel Sous Windows TM Pour la Génétique Des Populations. Laboratoire Génome, Populations, Interactions. CNRS UPR 9060, Université de Montpellier II, Montpellier (France).

Calmet C, Pascal M, Samadi S (2001) Is it worth eradicating the invasive pest Rattus norvegicus from Molène archipelago? Genetic structure as a decision-making tool. Biodiversity and Conservation, 10, 911–928. Cosson JF (1998) Historical biogeography of two competing shrews of the genus Crocidura inferred from mt DNA variation. In: Euro-American Mammal Congress. Cosson JF, Pascal M, Bioret F (1996) Origine et répartition des musaraignes du genre Crocidura dans les îles bretonnes. Vie et Milieu — Life and Environment, 46, 233–244. Estoup A, Turgeon J (1996) Microsatellite markers: isolation with non-radioactive probes and amplification available at http:// www.inapg.inra.fr/dsa/microsat/microsat.html. Fons R (1984) La Crocidure des Jardins Crocidura suaveolens. In: Atlas Des Mammifères de France (ed. Société Française Pour l’Étude et la Protection Des Mammifères, Paris), pp. 46 – 47. Société Française Pour l’Étude et la Protection Des Mammifères, Paris. Jacob HJ (1995) A genetic linkage map of the laboratory rat, Rattus norvegicus. Nature Genetics, 9, 63–69. Libois R, Ramalhinho MG, Fons R (1999) Crocidura suaveolens (Pallas, 1811). In: The Atlas of European Mammals (eds Mitchell-Jones A J et al.), pp. 72–73. Academic Press, London San Diego. Pascal M, Siorat F, Bernard F (1998) Interactions between Norway rats and shrews in Brittany Islands. Aliens, 8, 7. Raymond M, Rousset F (1995) genepop Version 1.2.: population genetics software for exact test and ecumenicism. Journal of Heredity, 86, 248–249. Rozen S, Skaletsky HJ (1998) Primer3, Code available at http:// www.genome.wi.mit.edu/genome_software/other/primer3.html. Wilson DE, Reeder DM (1993) Mammal Species of the World. Smithsonian Institut Press, Washington and London.

© 2004 Blackwell Publishing Ltd, Molecular Ecology Notes, 4, 426– 428