PHYSIOLOGIA PLANTARUM 123: 9–20. 2005 Printed in Denmark – all rights reserved
doi: 10.1111/j.1399-3054.2004.00438.x Copyright # Physiologia Plantarum 2004
Characterization of an unusually regulated gene encoding asparagine synthetase in the parasitic plant Striga hermonthica (Scrophulariaceae) Philippe Simiera, Philippe Delavaulta, Emilie Demarsyb, Jean-Bernard Pouvreauc, Karine Pageaud, Bruno Le Bizece, Andre´ Fera and Patrick Thalouarna a
Groupe de Physiologie et Pathologie Ve´ge´tales, Faculte´ des Sciences et Techniques, BP 92208, 2 rue de la Houssinie`re, F-44322 Nantes Cedex 3, France b Groupe de Physiologie et Pathologie Ve´ge´tales, Baˆtiment 8, Faculte´ des Sciences et Techniques, BP 92208, 2 rue de la Houssinie`re, F-44322 Nantes Cedex 3, France c Laboratoire de Ge´ne´tique Mole´culaire des Plantes. Plastes et Diffe´renciation Cellulaire, UMR CNRS 5575. CERMO, Universite´ Joseph Fourier BP53 F-38041 Grenoble cedex 9, France d Laboratoire d’Androge´ne`se et Biotechnologie Ve´ge´tale, Universite´ de Picardie Jules Verne, 80039 Amiens Cedex, France e LABERCA, E´cole Nationale Ve´te´rinaire de Nantes, Route de Gachet, BP50707, F-44307 Nantes Cedex 3, France *Corresponding author, e-mail:
[email protected] Received 21 July 2004; revised 20 September 2004
In the parasitic plant Striga hermonthica (Del. Benth), asparagine synthesis plays a prominent role in the metabolism of the host-derived nitrogen and in the detoxification process of a steady-state N-excess. Here, we show that asparagine synthetase (EC 6.3.5.4), the primary enzyme involved in asparagine production in plants, is encoded in Striga by a small gene family, with at least two AS genes, including the gene called ShAS related to the small class II Asparagine Synthetase genes. The functionality of ShAS was demonstrated by complementation of an E. coli asn auxotroph mutant and its expression was characterized by semiquantitative RT-PCR. The ShAS expression pattern in plants growing under standard light conditions and in light-grown calli differs from the expression pattern of most plant AS genes since ShAS tran-
scripts accumulated in all the plant organs and this accumulation was not repressed by light. In contrast, ShAS expression was light-induced in mature leaves and in the chlorophyllous calli. The promoter region of ShAS was also sequenced and characterized and displayed various light-responsive, as well as potential sugar-responsive, cis-elements. A correlation between ShAS expression and asparagine synthesis was demonstrated in the illuminated mature leaves by 15N-labelling in vivo experiments. ShAS was also shown to be positively regulated in light-grown calli by C- and N-starvation and was associated with senescence-related protein breakdown. ShAS expression was not repressed by light in haustoria, roots, senescing leaves and inflorescences. These findings show that one or more unknown factors of regulation can override light as the major regulator.
Introduction The parasitic weed Striga hermonthica is associated only with agroecosystems in Africa. It is now a serious problem on maize and sorghum in many areas, despite the fact that different methods of integrated control are available to farmers. The development of effective control strategies is a difficult challenge, notably due to the complex biology of this parasitic species (Eplee and Norris 1995). Once attached to the host root, Striga connects with the host xylem vessels via the primary
haustorium (Do¨rr 1997) and grows underground for about 4–6 weeks. After emergence above ground, it develops numerous thin adventitious roots carrying secondary haustoria and a photosynthetic leafy shoot. The parasite displays a high transpiration rate that maintains intensive xylem sap uptake from the infested plant (Ehleringer and Marshall 1995). One of the more difficult challenges for the efficient control of Striga is the identification of a metabolic process specific and essential to Striga that
Abbreviations – AS, asparagine synthetase; asn, asparagine; dae, day after emergence above ground; FAAs, total free amino acids; PAR, photosynthetically active radiation Physiol. Plant. 123, 2005
9
may represent a biochemical target. This emphasizes the need for a better understanding of the metabolic traits of this parasite. Unlike the infested cereal, S. hermonthica produces mannitol as an essential step in photosynthetic carbon assimilation (Press 1995). Characterization of potential herbicides specifically targeted against this metabolism is in progress (Robert et al. 1999, A. Rousset 2003, Thesis, University of Nantes, France). Some traits of nitrogen assimilation in this crop pathogen also deserve to be highlighted. Its high transpiration rate during illumination acts as the major driving force for N-uptake from the host xylem sap. Pageau et al. (2003) have recently shown, using 15N as an isotopic tracer, that the majority of nitrate taken from the soil by the roots of the infested sorghum is transported unchanged to Striga leaves through the transpiration stream. Because of the relatively low photosynthetic rate (Press 1995), the leaf N/C ratio reaches a high value in Striga (Pageau et al. 2003). Nevertheless, the parasite succeeds in coping with a Nexcess in light by producing and strongly accumulating the N-rich compound, asn, which represents 80% of total free amino acids (FAAs) and almost 6% of the DW in shoots. The incorporation of ammonium normally proceeds in plants via the enzymes glutamine synthetase (GS) and glutamate synthase. However, it was recently shown in transgenic Medicago truncatula that GS can be substituted by AS for ammonium assimilation when GS is limited (Carvalho et al. 2003). A low GS activity has been reported in some parasitic species (Press 1995), including S. hermonthica (Igbinnosa and Thalouarn 1996). Accordingly, it is likely that asn synthesis is a metabolic adaptation in Striga for coping with the low GS activity. In plants, asn production is commonly described as a metabolic process that is darkness-induced and rootenhanced in response to C limitation or is involved in N-mobilization during senescence (King et al. 1990, Brouquisse et al. 1992, Lam et al. 1994, Fujiki et al. 2001). To date, no other plant species share with S. hermonthica the metabolic trait to produce and accumulate asn intensively and specifically in well-illuminated leaves. This suggests an unusual regulation of asn metabolism in Striga. Asparagine Synthetase (AS, EC 6.3.5.4) is the primary enzyme involved in the production of asn (Ireland and Lea 1999). Biochemical approaches to AS analysis are known to be difficult (Ta et al. 1989) and even nonexistent for AS extracted from photosynthetic organs. Since preliminary AS assays were unsatisfactory in Striga, labelling experiments were carried out in the present study to estimate 15N incorporation into asn, which gave an indirect measure of AS activity (Waterhouse et al. 1996). Therefore, a molecular approach is needed to characterize AS in the parasitic species by analysing AS gene structure and expression. Here, we report the characterization of an unusually regulated cDNA encoding AS and discuss in particular its contribution to several metabolic processes essential for Striga, such as 10
adaptation to a steady-state N excess in mature leaves, N-remobilization during leaf senescence and hostderived N conversion into asn in haustoria.
Materials and methods Striga hermonthica Del. Benth (Scrophulariaceae) was grown on Sorghum bicolor L. cv. SH4 Arval (Poaceae) in a greenhouse, under a N-fertilization regime of 30 kg N ha1 (KNO3 solution) and controlled-environment conditions, e.g. 14 h photoperiod, 300 mmoles m2 s1 photosynthetic active radiation (PAR), 30–35 C daynight (Pageau et al. 2003). For RNA extraction, the parasite was harvested 60 days after emergence from the soil (dae), at the 8th hour after the beginning of the 14 h-period of illumination, or at the 6th hour after the beginning of the 8 h-period of darkness. Striga was in blossom and the old leaves were senescing at the harvest date. Striga calli were grown at 25 C under continuous light (40 mmoles m2 s1 PAR) in C- and N-sufficient conditions (Rousset et al. 2003). The solidified culture medium (0.4% agargel) was complemented with 0.5 mg l1 a-naphthalene-acetic acid, 2.5 mg l1 benzylaminopurine, 2% sucrose and 200 mg l1 casein hydrolysate (Bactocasamino Acids, Becton, Dickinson and Company, Franklin Lakes, NJ), MS vitamins and salts, including 18 mM KNO3 and 40 mM NH4NO3. Calli were maintained by subculturing on fresh medium at 30–40 day intervals. Senescence was induced by subculturing some lightgrown calli in C- and N-insufficient conditions on a medium depleted of sucrose and N-resources (nitrate, ammonium and Bactocasamino Acids). The complementation experiments were performed as described by Osuna et al. (2001), using the E. coli asn auxotroph, ER (asnB32, l-, relA1, spoT1, asnA31, thi-1), obtained from the E. coli Genetic Stock Center (New Haven, CT).
Isolation of a ShAS cDNA Total RNA was isolated from up to 0.1 g of leaf FW using the RNeasy Mini kit (Qiagen, Hilden, Germany) and treated by Dnase I enzyme (Sigma, Saint Quentin Fallavier, France). First-strand cDNA was synthesized from 1 mg of total RNA using the SuperScript II Reverse Transcriptase enzyme according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Several sequences of AS cDNA from different plant species were aligned in order to identify conserved regions used to design two oligonucleotides (ASPA1, 50 -ATGTGTGGIATWCTTGCHGT and ASPA2, 50 -CACCATCACTAAACTGTTCT, Fig. 1). With these primers, a first 1366-bp fragment was isolated by RT-PCR, cloned into pCR2.1-TOPO (Invitrogen), then sequenced by the DNA sequencing department of the Eurogentec company (Ivoz-Ramet, Belgium). From this sequence, two specific oligonucleotides (ASN6, Physiol. Plant. 123, 2005
Fig. 1. Nucleotide sequence of a cDNA encoding a Striga hermonthica AS. The initiation ATG codon is boldfaced and the translation termination codon is designated with an asterisk. The deduced amino acid sequence is denoted below the cDNA sequence. Putative plant polyadenylation signals are double-underlined. Primers used in PCR experiments are labelled and underlined.
50 -CAAACGCGTTGCGCAGAATCCACTTCTC and ASN4, 50 -CATGTCGAAAGATCAAAGCGCTTCAT) were generated to amplify two cDNA fragments containing the 50 - and 30 -ends, using 50 - and 30 -RACE strategies (Invitrogen), respectively. Both fragments were cloned and sequenced as mentioned above. Southern blot analysis Total DNA was isolated from individual plants using the DNeasy plant maxi kit from Qiagen, digested (10 mg) overnight with restriction enzymes, fractionated on a 0.7% 1X TBE agarose gel and transferred onto Hybond-N1 nylon membrane (Amersham Biosciences, Physiol. Plant. 123, 2005
Pisscataway, NJ) using a standard transfer method (Sambrook et al. 1989). DNA was cross-linked to the membrane in a Crosslinker CL-508 (UVItec, Cambridge, UK). 32P-labelled cDNA probes were generated using 50 ng of ShAS cDNA in a random priming reaction consisting of 5 ml [a-32P]dCTP (111 TBq mmol1, Amersham Biosciences) and the reagents from a Ready-To-Go DNA labelling beads kit (Amersham Biosciences). Membranes were prehybridized for 30 min at 60 C in ExpressHyb solution (BD Biosciences, Palo Alto, CA) and subsequently hybridized for 2 h at 60 C in ExpressHyb solution containing 33 KBq ml1 of cDNA probe. Membranes were rinsed in 2 SSC, 0.05% w/v SDS at room temperature for 30 min followed by stringent washing in 11
0.1 SSC, 0.1% w/v SDS at 50 C for 10 min, and autoradiography films were exposed to the membranes at 80 C. RT-PCR analysis of gene expression First-strand cDNA was synthesized from 1 mg of total RNA as described above. Independent PCR reactions using equal aliquots (2 ml) of cDNA samples were performed using ShAS-specific primers (Fig. 1). Primer sets were chosen in such a way that a genomic DNA amplification gave a product containing at least an intron, allowing a direct confirmation that RT-PCR products were of mRNA origin. Annealing conditions were empirically determined. Preliminary experiments demonstrated that the amount of PCR product increased with increasing numbers of cycles, indicating that the reaction components were not a limiting factor (data not shown). Amplification of the ef-1a gene exhibiting constitutive expression was used as a positive control, thus showing the linear relationship between the amount of RNA used and the amount of cDNA fragment amplified as well as the quality of both extracted RNA and RT-PCR reactions. The RT-PCR products were separated on a 1.5% w/v agarose gel, transferred to a nylon membrane and hybridized with a ShAS probe, as described above. Chromosome walking by PCR The ShAS promoter region was isolated using the Universal Genomewalker kit from BD Biosciences. Using the provided adaptator primers and a ShAS-specific primer, ASNGW1 (Fig. 1), LD-PCR products were generated by TaKaRa LA Taq enzyme (BioWhittaker, Verviers, Belgium) following the manufacturer’s recommendations. LD-PCR products were cloned into the pC2.1-TOPO vector and sequencing was carried out as above. Labelling experiments using excised shoots Leafy shoots of 60-day-old parasites were excised at the 4th hour of illumination. Stems were dipped into 5 mM KNO3 (99 atoms percentage 15N, Euriso-top) for 6 h at 25 C under continuous light (300 mmoles m2 s1 PAR). Content and 15 N-enrichment of the major FAAs of mature leaves (Pageau et al. 2003), e.g. aspartate, glutamate, asparagine and glutamine, were determined by ion exchange HPLC (Biotronik LC 5001 analyser) and Isotopic Ratio Mass Spectrometry and by Gas Chromatography-Mass-Spectrometry, respectively, as described by Pageau et al. (2003). Nitrate was extracted from 1 g FW in 20 ml of ultra-pure water and quantified as described below. Biochemical analyses of calli FAAs and proteins were extracted from 0.5 g FW of calli in 5 ml of 0.2 M NaOH (Vadez et al. 2000). After homogenization (Ultra-Turrax, 24 000 r.p.m. for 3 15 s) 12
then centrifugation (12 000 g for 10 min), FAAs and proteins were quantified in supernatants as described by Yemm and Cocking (1955) and Bradford (1976), respectively. Nitrate and ammonium were extracted from 0.05 g FW in 5 ml of ultra-pure water following incubation at 100 C for 20 min. After centrifugation (12 000 g for 10 min), supernatants were collected and pellets suspended in 5 ml of ultra-pure water. Incubation followed by centrifugation was repeated once after which the supernatants were combined. Nitrate and ammonium were spectrophotometrically quantified using a Skalar autoanalyser (Strickland and Parsons 1972).
Results Isolation and characterization of an AS cDNA AS cDNA sequences from different plant species were aligned in order to identify conserved regions that were subsequently used to design two oligonucleotides and (ASPA1, 50 -ATGTGTGGIATWCTTGCHGT ASPA2, 50 -CACCATCACTAAACTGTTCT). With these primers, a first 1366-bp fragment was isolated by RTPCR, cloned into pCR2.1-TOPO and sequenced. From this sequence, two specific oligonucleotides (ASN6, and 50 -CAAACGCGTTGCGCAGAATCCACTTCTC ASN4, 50 -CATGTCGAAAGATCAAAGCGCTTCAT) were generated to amplify two cDNA fragments containing the 50 - and 30 -ends, using 50 - and 30 -RACE strategies, respectively. Both fragments were cloned and sequenced. A total identification of the overlapping nucleotide sequence of the three PCR products suggested that they corresponded to the same gene and constituted a 2278-bp length cDNA, named ShAS (Fig. 1, GenBank accession number AF530460). Moreover, an end-to-end PCR gave a unique product with the expected size, confirming that the sequence presented is not a chimera coming from different genes but a true fulllength cDNA. At the 30 end, different well-described putative plant polyadenylation signals could be detected: the sequences (TTTGTA) (AATAAA) and (TA) show perfect homology with the consensus plant sequences FUE (farupstream element, UUUGUA), NUE (near-upstream element, AAUAAA) and CS (cleavage site, YA), respectively (Rothnie 1996). This cDNA contains a 1713-bp open reading frame encoding a 571 amino acid protein (ShAS) with a predicted molecular mass of 64.3 kDa and an isoelectric point of 6.61. The deduced amino acid sequence of ShAS was aligned with five other AS sequences from different organisms to identify the conserved regions (Fig. 2). The N-terminal portion of ShAS is quite conserved compared to other plant AS proteins, whereas the C-terminal is slightly shorter and the last 20 amino acid residues show considerable variation. The ShAS sequence conserves a number of specific amino acid stretches of plant AS (Fig. 2), notably those demonstrating its membership of the ATP-dependent class-II (also purF-type) Physiol. Plant. 123, 2005
Fig. 2. Alignment of deduced amino acid sequences of several AS from Striga hermonthica (ShAS), Helianthus annuus (HaAS2), Arabidopsis thaliana (AtAS3), Oryza sativa (OsAS), Triphysaria versicolor (TvAS6) and Escherichia coli (EcASB). Alignment was performed using the ClustalW software. Only substitutions compared to S. hermonthica sequence are shown, dashes represent the gaps introduced to maximize similarity. Essential residues from the glutamine-binding domain are boxed (Zalkin and Smith 1998, Herrera-Rodrı´ guez et al. 2002); aspartate-binding domain, black dots (Boehlein et al. 1997a, b); residues proposed to be responsible for the anchoring of the AMP moiety, white squares (HerreraRodrı´ guez et al. 2002); pyrophosphate-binding domain, underlined (Richards and Schuster 1998); Unique sequence features specific to AS class II sequences are labelled with black squares.
Physiol. Plant. 123, 2005
13
glutamine amidotransferase family (Lam et al. 1994, Osuna et al. 2001, Herrera-Rodrı´ guez et al. 2002). The predicted amino acid sequence of ShAS displays significant similarity to other plant AS sequences, especially to sunflower AS2 (87.9%), Arabidopsis ASN2 (87.2%) and ASN3 (86.6%) and rice AS (86.5%). A phylogenetic analysis was carried out with 25 deduced AS amino acid sequences (Fig. 3). It revealed the two recently redefined classes I and II of AS proteins (Herrera-Rodrı´ guez et al. 2002) and showed that ShAS is more closely related to the class II ASs. Moreover, of the seven unique sequence features specific to class II sequences, six are maintained in ShAS (Fig. 2). Southern analysis of genomic DNA A blot of genomic DNA from S. hermonthica digested with four different enzymes (EcoRI, HindIII, BglII and EcoRV) was probed with a cDNA fragment corresponding to most of the ShAS coding region (Fig. 4). Hybridization gave a major hybridizing band for every restriction assay that we attributed to the sequence corresponding specifically to ShAS. Several weakly hybridizing bands were also detected in each lane, corresponding to sequences sharing some homology with ShAS. We interpret this hybridization pattern to indicate that asparagine synthetase is encoded by a small family of related genes within the Striga genome. Complementation of an E. coli asn auxotroph with pUShAS The complete coding sequence of the ShAS cDNA was amplified using the primers EASSH (50 -CGGA ATTCCATGTGTGGGATTCTGG) and 3ASSH (50 CGCGGATCCGCGCTACTCTTTGGGAGAG) containing the EcoRI and BamHI restriction sites, respectively. To check the sequence, the amplified cDNA was cloned in the pCR2.1-TOPO plasmid, and subcloned in-frame, following an EcoRI–BamHI digestion, in pUC18. The resulting plasmid, pUShAS, was used to transform the E. coli auxotroph mutant lacking AS activity, ER. The strain transformed with pUC18 grew well in the presence of asn and did not grow in M9 medium without asn (Fig. 5). On the other hand, when transformed with pUShAS, the strain grew even in the absence of asn, indicating that the ShASencoded protein displays AS functionality. Characterization of the promoter region of ShAS Using a PCR genome walking strategy, a 1315 nt sequence upstream of the initiation ATG codon was isolated. This ShAS promoter region was analysed with PLACE software (Higo et al. 1999). The GenBank accession number for the ShAS promoter sequence is AY684304. The putative transcriptional initiation site 14
Fig. 3. Evolutionary relationships between different AS. The tree was constructed using the TreeView software after a multiple sequence comparison following the Clustal method of the ClustalW program. The peptide sequences are AS from Striga (ShAS), sunflower (HaAS1 and 2), Arabidopsis (AtASN1, 2 and 3), maize (ZmAS), rice (OsAS), asparagus (AoAS), barley (HvAS1), cabbage (BoAS), pea (PvAS1 and 2), soybean (GmAS1 and 2), lotus (LjAS1 and 2), alfalfa (MsAS), faba bean (VfAS), Triphysaria (TvASE, B and 6), and E. coli (EcASNB).
of ShAS was determined by a 50 RACE assay and is numbered as 11 (Fig. 6). A putative TATA-like sequence was found at nucleotide 170 (TTATTT) (Tjaden et al. 1995). This region encompasses various potential sugar-responsive, as well as light-responsive, ciselements. It includes an AATACTAAT sequence named SURE2 (Suc-Responsive Element 2) and described as a prerequisite for positive sugar control in upregulated genes (Grierson et al. 1994). The SURE2 box is located at position 185. A TACGTA sequence present in an a-amylase promoter of rice as an essential element of repression by sugar (Toyofuku et al. 1998) is located in the middle part of the ShAS promoter at 619. Concerning the putative light-responsive cis-elements, computer analysis of the ShAS promoter revealed two copies of the conserved sequence upstream of light-regulated genes of both monocots and dicots, known as I-box Physiol. Plant. 123, 2005
Organ-specific expression of ShAS The quantity of RNA extracted from the very small haustoria (1 mm-diameter at the most) was insufficient for Northern blot analysis. Consequently, the organspecific expression pattern of ShAS transcripts was characterized by semiquantitative RT-PCR (Fig. 7). In the emerged Striga harvested at the 8th hour of light, ShAS transcripts were detected in all the organs, subterranean or aerial. Nevertheless, their abundance was significantly greater in the mature leaves and the inflorescences. ShAS is also expressed in the chlorophyllous calli developed from leaf explants under continuous light and C- and N-sufficient conditions. Consequently, both plants and calli were used to study the regulatory pattern of ShAS. Diurnal synthesis of asn in mature leaves 15
N-nitrate was transported to the leaves of excised stems through the transpiration stream, thus leading to an intensive 15N-incorporation into the FAAs, mainly into asn (Table 1). In fact, 15N corresponded to 15% of N-atoms contained in the asn pool, which represented almost 80% of the FAAs. In contrast, nitrate content remained low in these organs. Fig. 4. Southern analysis of ShAS gene in S. hermonthica. Total genomic DNA was digested with EcoRI, HindIII, BglII and EcoRV as noted above lanes. The migration positions of the molecular weight standards are indicated on the right (kb).
(GATAA) (Terzaghi and Cashmore 1995), nine GT-1 related binding sites, five GATA motifs (Gilmartin et al. 1990) and an REa element required for phytochrome regulation of the Lemna gibba Lhcb2*1 gene (Degenhardt and Tobin 1996).
2 pUShAS –
1.8
pUShAS +
1.6
pUC18 –
1.4 OD 550 nm
pUC18 + 1.2 1 0.8 0.6 0.4
Effect of darkness and C- and N-starvation on ShAS expression ShAS transcripts were widely distributed in a variety of organs of Striga plants growing under standard light conditions (Fig. 7) and they accumulated independently of light in roots, haustoria and inflorescences (Fig. 8). In contrast, ShAS expression was shown to be positively regulated by light in both the mature leaves and the light-grown calli cultured in C- and N-sufficient conditions. The impact of senescence-inducing conditions on the expression of ShAS in calli was studied following transfer to a solidified medium containing neither sucrose nor N resources (Fig. 9). ShAS expression did not change during the first 3 days of starvation, which induced the mobilization of stored soluble carbohydrates, FAAs and nitrate. The starvation had to be prolonged to 5–7 days to induce proteolysis and a concomitant increase in ShAS expression. The ammonium pool was halved after 7-day starvation but remained at a relatively high level in comparison with nitrate and FAAs. A prolonged 11-day starvation resulted in a drop in ShAS expression when calli turned brown.
0.2 0 0
4
8
12
16
20
24
28
Time (hour)
Fig. 5. Complementation of an asn auxotroph E. coli (ER). Plasmids pUC18 (control) and pUShAS were transformed into the AS mutant ER. Culture were grown in M9 media in the presence or absence of 100 mg ml1 asparagine. n ER/pUC18 (–) Asn, & ER/ pUC18 (1) Asn, ~ ER/pUShAS (–) Asn, and & ER/ pUShAS (1) Asn. Physiol. Plant. 123, 2005
Discussion Numerous chlorophyllous parasitic plants, including Striga hermonthica, connect to the xylem vessels of the infested plants and accumulate N in the leaves (Quested et al. 2002) as a result of the imbalance between a relatively low photosynthetic capacity and intensive hostderived N importation. Thus, the stem parasite Viscum 15
–508 –1070
–882
–1013
–619
–328
TATA box –170 –185
–263
+1
+246
–927
–973
–974
–975
–1056
ATG –840 –771
–543
–473 –411
Fig. 6. Schematic representation of the ShAS promoter region. The positions of putative sugar (square) and light (triangle) responsive elements are shown with respect to the transcriptional initiation site (1 1). SURE2 motif, black square; TACGTA sequence, white square; I-box, grey triangle; GT-1 binding site, white triangle; GATA motif, black triangle; REa element, hatched triangle. Position over or under the promoter line stands for plus or minus strand, respectively.
album strongly accumulates the rich N-compound arginine in the leaves as an indication of excess N supply from the host xylem sap (Escher et al. 2004). In S. hermonthica, a strong accumulation of asn is the key factor in N management in the illuminated leaves (Pageau et al. 2003). Identification of several AS genes in Striga and sequence characterization of the gene ShAS Some legumes contain two closely related AS genes that display similar patterns of regulation by light and carbohydrates (Tsai and Coruzzi 1991, Waterhouse et al. 1996, Hughes et al. 1997, Osuna et al. 2001). At least two distinct AS genes have been reported in several monocot plants (Chevalier et al. 1996, Møller et al. 2003, Gallais and Hirel 2004). Similarly, the AS family in barley contains two genes, HvAS1 and HvAS2 (Møller et al. 2003). However, only the HvAS1 gene expression is enhanced by prolonged periods of darkness while both genes are expressed in these organs under normal growth conditions. In addition, three distinct and differently regulated AS genes have been reported in Arabidopsis thaliana (ASN1, ASN2, ASN3, Lam et al. 1998) and more recently in sunflower (Herrera-Rodrı´ guez et al. 2002, 2004). We have shown in the present study that
H
R
L
I
C
ef-1α
AS is also encoded in Striga by a small gene family (Fig. 4). Our efforts were focused here on the characterization of a gene called ShAS. Its deduced protein sequence clusters with the dendritic group II ASs (Fig. 3, Herrera-Rodrı´ guez et al. 2002), while most of the AS proteins belong to class I. Hence, ShAS protein is a new member of the small class II, formed to date by HAS2 of sunflower, ASN2 and ASN3 of Arabidopsis plus the AS from rice and maize. Nevertheless, the AS protein predicted from the ShAS sequence displays the characteristic features of plant AS composed of 579–591 amino acids with a predicted molecular mass of about 65 kDa (Shi et al. 1997). As has already been shown for AS from common bean (Osuna et al. 2001) and sunflower (Herrera-Rodrı´ guez et al. 2002, 2004), the functionality of ShAS was clearly demonstrated by complementation of an E. coli asn auxotroph mutant (Fig. 5). Regulatory pattern of ShAS The expression of plant AS genes is usually limited to particular organs and is negatively regulated by light (Tsai and Coruzzi 1991, Yamagata et al. 1998). In contrast, ShAS does not follow this typical pattern since its expression is widespread (Fig. 7) and is not repressed by light in Striga plants growing under standard light conditions (Fig. 8). Moreover, ShAS expression is upregulated by light in the mature leaves and in the light-grown calli. To date, only Arabidopsis ASN2, which belongs to the non-light-repressible class II AS genes like ShAS
Table 1. 15N-enrichment (%) and amount (mmol g1 FW) of nitrate and major FAAs in Striga mature leaves following a supply of excised stems with K15NO3 (5 mM, 99 atoms percentage 15N Values are expressed as means -confidence intervals (n ¼ 5; P ¼ 0.05; Student’s t-test); nd: not determined.).
Sh-AS Fig. 7. RT-PCR analysis of ShAS transcripts in different organs of emerged Striga harvested at the 8th hour of light and in light-grown calli. H, haustoria; R, roots; L, leaves; I, inflorescence; C, calli. The ef-1a gene exhibiting constitutive expression was used as a positive control of RT-PCR reactions.
16
15
Amount
nd 22.50 1.0 31.90 2.3 20.80 0.80 15.35 0.70 –
0.49 0.04 9.91 1.25 7.10 0.14 11.99 2.00 247.70 21.02 313.11 35.55
N-enrichment
Nitrate Glutamate Aspartate Glutamine Asparagine Total FAAs
Physiol. Plant. 123, 2005
calli
inflorescences
leaves
roots
haustoria
D L D L D L D L
0
D L
Days of starvation 1 3 5 7
11
ef-1α Sh-AS
Physiol. Plant. 123, 2005
9 6 3
Content (mg g–1 FW)
15
FAAs
12 9 6 3 0
Content (µmol g–1 FW)
(Fig. 3, Herrera-Rodrı´ guez et al. 2002), is known to be positively regulated by light. Hence, ShAS and ASN2 are the sole AS genes known to date to be light-induced. All the other class II AS genes, such as Asparagus AS (Davies and King 1993), HAS2 of sunflower (HerreraRodrı´ guez et al. 2002) and rice AS (Nakano et al. 2000), are unaffected rather than induced by light. The unusual light-stimulated expression of ShAS in the mature leaves is quite appropriate to satisfy the demand for asn to cope with intensive host-derived nitrate importation during illumination. This finding suggests that the AS protein encoded by ShAS is the direct supplier of asn in illuminated mature leaves, the organs that most actively accumulate asn (Pageau et al. 2003). The AS protein was not detected in the present study. Nevertheless, we succeeded in detecting AS activity in crude extracts of the illuminated leaves (data not shown) using the Romagni and Dayan (2000) protocol yielding highly active AS in the crude extracts of plants. However, the AS activity was rapidly lost leading to non-reproducible data. This protocol was developed for ASs extracted from non-chlorophyllous and etiolated tissues, hence no protocol yielding active and stable AS from photosynthetic tissues is available to date. Nevertheless, we have provided evidence that in vivo ShAS gene expression correlates with asn production in illuminated Striga leaves. Indeed the mature leaves of excised shoots dipped in 15N-nitrate solution displayed an intensive 15N-incorporation into asn (Table 1). The light regulation of AS genes has been shown to be partially mediated via phytochrome in the etiolated seedlings of pea and Arabidopsis (Lam et al. 1994, Ngai et al. 1997), or indirectly via light-induced changes in the sucrose content or the subsequent C/N ratio for AS in excised root tips of maize (Chevalier et al. 1996), for AS1 in tomato (Devaux et al. 2003), for ASN1 and ASN3 in intact Arabidopsis plants (Lam et al. 1994,
Soluble carbohydrates
0
Content (mg g–1 FW)
Fig. 8. RT-PCR analysis of ShAS transcripts in haustoria, roots, mature leaves and inflorescences of emerged Striga and in calli exposed to different light conditions. L, light; D, darkness. The ef-1a gene exhibiting constitutive expression was used as a positive control of RT-PCR reactions. Ef-1a picture corresponds to agarose gel migration.
32
Nitrate
24 16 8 0 Soluble proteins 12 9 6 3 0
Content (µmol g–1 FW)
Sh-AS
Content (mg g–1 FW)
12
ef-1α
Ammonium 16 12 8 4 0
Fig. 9. RT-PCR analysis of ShAS transcripts in light-grown calli exposed to C and N-insufficient conditions and changes in carbohydrate and N-compound contents during starvation. The ef-1a gene exhibiting constitutive expression was used as a positive control of RT-PCR reactions.
17
1998, Thum et al. 2003) and for HvAS1 in barley leaves (Møller et al. 2003). While a number of putative lightresponsive sequences were found in the promoter region of ShAS in Striga (Fig. 6), their functionality needs to be proved for a better understanding of the mechanisms involved in the positive light regulation of ShAS. The expression of ShAS is not regulated by light in haustoria (Fig. 8), which could reflect the continuous conversion of a part of the host-derived N into asn, as suggested by Pageau et al. (2003). Indeed transpiration and host-xylem sap uptake are maintained in darkness (Ehleringer and Marshall 1995). Delavault et al. (1998) have already reported the expression of an AS gene in the haustoria of another root-parasitic plant Triphysaria versicolor. However, the deduced protein sequence is quite distinct from that of ShAS (Fig. 3), in spite of S. hermonthica and T. versicolor being closely related phylogenically. Moreover, as indicated in some other plant species (Fujiki et al. 2001), the accumulation of ShAS transcripts in senescing calli (Fig. 9) suggests that asn production mediated by ShAS could be involved in N-remobilization in Striga plants and in the assimilation of ammonia resulting from senescence-related protein degradation. Indeed, ShAS expression was shown to be upregulated in the senescing calli growing in continuous light, where proteolysis, a high ammonia level and enhanced ShAS expression are concomitantly induced (Fig. 9). A similar process was previously described in the starved root tips of maize (Brouquisse et al. 1992, 1998) as a metabolic adaptation for supplying respiration to C depletion. It was also shown that the ShAS transcripts accumulated in the senescing leaves of Striga and the expression was not light-regulated (data not shown). Light is not the major regulator of ShAS in several organs The different pattern of ShAS expression in response to light according to the organ (Fig. 8) and the leaf developmental stage indicates that one or more unknown parameters override light as the major upregulator. In light-grown plants of A. thaliana, carbon (sucrose) appears to attenuate the light regulation of ASN2 (Thum et al. 2003). Whatever the organ, such an attenuation for ShAS is unlikely in Striga, where sucrose does not accumulate (Pageau K, personal communication). On the other hand, the strong and widespread accumulation of mannitol in Striga (Press 1995) could favour ShAS gene expression through an induction related to carbon deficiency. Indeed, Chevalier et al. (1996) have shown that mannitol, acting as a non-metabolizable sugar, induced AS expression in the excised roots of maize. AS transfers the amide group from glutamine to aspartate in an ATP-dependent reaction. While all plant ASs purified to date are of the glutamine-dependent type, they can catalyse asn production in vitro in the presence of aspartate and a high ammonia concentration (Brouquisse et al. 1992, Brears et al. 1993). Numerous 18
physiological studies suggest that asn accumulation correlates with ammonium metabolism, especially under photorespiration-inducing conditions (Ta 1986), as a consequence of stress (Chevalier et al. 1996, Fukutoku and Yamada 2002) and senescence- or sugar-starvation-related protein breakdown (Groat and Vance 1981, Genix et al. 1994, Brouquisse et al. 1998, Baldet et al. 2002, Devaux et al. 2003). Accordingly, some AS genes, including the three AS genes in Helianthus (Herrera-Rodrı´ guez et al. 2004) and the ASN2 gene in A. thaliana (Wong et al. 2004), are ammonium-induced. From the data showing the gene expression during senescence in calli (Fig. 9) and leaves, an ammonia-related regulation can be envisaged for ShAS in Striga. An interesting question is to what extent asn synthesis protects Striga against N-toxicity in the case of higher N-fertilization regimes. This point will be addressed in future work. In darkness, transpiration and host-xylem sap uptake are maintained (Ehleringer and Marshall 1995). With the exception of the significant reduction in ShAS expression in mature leaves demonstrated in the present study, nothing else is known about nitrogen nutrition and metabolism in Striga leaves during darkness. Since ShAS is not the sole AS gene in this parasitic species (Fig. 4), the role and contribution of the other AS genes in nitrogen assimilation needs to be studied and elucidated. Acknowledgements – The authors thank Eva Arnaud, Sabine Delgrange, Dominique Bozec and Johannes Schmidt for excellent technical assistance and Fabrice Monteau (LABERCA, Nantes) for his help in GC-MS determinations.
References Baldet P, Devaux C, Chevalier C, Brouquisse R, Just D, Raymont P (2002) Contrasted response to carbohydrate limitation in tomato fruit in two stages of development. Plant Cell Envir 25: 1639–1649 Boehlein SK, Walworth ES, Schuster SM (1997a) Identification of cysteine-523 in the aspartate binding site of Escherichia coli asparagine synthetase B. Biochem 36: 10168–10177 Boehlein SK, Walworth ES, Richards NG, Schuster SM (1997b) Mutagenesis and chemical rescue indicate residues involved in beta-aspartyl-AMP formation by Escherichia coli asparagine synthetase B. J Biol Chem 272: 12384–12392 Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254 Brears T, Liu C, Knight TJ, Coruzzi GM (1993) Ectopic overexpression of asparagine synthetase in transgenic tobacco. Plant Physiol 103: 1285–1290 Brouquisse R, Gaudille`re JP, Raymond P (1998) Induction of a carbon-starvation-related proteolysis in whole maize plants submitted to light/dark cycles and to extended darkness. Plant Physiol 117: 1281–1291 Brouquisse R, James F, Pradet A, Raymond P (1992) Asparagine metabolism and nitrogen distribution during protein degradation in sugar-starved maize root tips. Planta 188: 384–395 Carvalho HG, Lopes-Cardoso IA, Lima LM, Melo PM, Cullimore JV (2003) Nodule-specific modulation of glutamine synthetase in transgenic Medicago truncatula leads to inverse alterations in asparagine synthetase expression. Plant Physiol 133: 243–252 Chevalier C, Bourgeois E, Just D, Raymond P (1996) Metabolic regulation of asparagine synthetase gene expression in maize (Zea mays L.) root tips. Plant J 9: 1–11 Physiol. Plant. 123, 2005
Davies KM, King GA (1993) Isolation and characterization of a cDNA clone for a harvest-induced asparagine synthetase from Asparagus officinalis. Plant Physiol 102: 1337–1340 Degenhardt J, Tobin EM (1996) A DNA binding activity for one of two closely defined phytochrome regulatory elements in an Lhcb promoter is more abundant in etiolated than in green plants. Plant Cell 8: 31–41 Delavault P, Estabrook E, Albrecht H, Wrobel R, Yoder JI (1998) Host-root exudates increase gene expression of asparagine synthetase in the roots of a hemiparasitic plant Triphysaria versicolor (Srophulariaceae). Gene 222: 155–162 Devaux C, Baldet P, Joubes J, Dieuaide-Noubhani M, Just D, Chevalier C, Raymond P (2003) Physiological, biochemical and analysis of sugar-starvation responses in tomato roots. J Exp Bot 54: 1143–1151 Do¨rr I (1997) How Striga parasitizes its host: a TEM and SEM study. Ann Bot 79: 463–472 Ehleringer JR, Marshall JD (1995) Water relations. In: Press MC, Graves JD (eds) Parasitic Plants. Chapman & Hall, London, pp 125–140 Eplee RE, Norris R (1995) Parasitic plants as weeds. In: Press MC, Graves JD (eds) Parasitic Plants. Chapman & Hall, London, pp 256–277 Escher P, Eiblmeier M, Hetzger I, Rennenberg H (2004) Spatial and seasonal variation in amino compounds in the xylem sap of a mistletoe (Viscum album) and its hosts (Populus spp. & Abies alba). Tree Physiol 24: 639–650 Fujiki Y, Yoshikawa Y, Sato T, Inada N, Ito M, Nishida I, Watanabe A (2001) Dark-inducible genes from Arabidopsis thaliana are associated with leaf senescence and repressed by sugars. Physiol Plant 111: 345–352 Fukutoku Y, Yamada Y (2002) Source of proline-nitrogen in waterstressed soybean (Glycine max): fate of nitrogen-15-labelled protein. Physiol Plant 61: 622–628 Gallais A, Hirel B (2004) An approach to the genetics of nitrogen use efficiency in maize. J Exp Bot 55: 295–306 Genix P, Bligny R, Martin JB, Douce R (1994) Transient accumulation of asparagine in sycamore cells after a long period of sucrose starvation. Plant Physiol 94: 717–722 Gierson CJS, de Torres Zabala M, Beggs K, Smith C, Holdsworth M, Bevan M (1994) Separate cis sequences and trans factors direct metabolic and developmental regulation of a potato tuber storage protein gene. Plant J 5: 815–826 Gilmartin PM, Sarokin J, Memelink J, Chua NH (1990) Molecular light switches for plant genes. Plant Cell 2: 369–378 Groat RG, Vance CP (1981) Root nodule enzymes of ammonia assimilation in alfafa (Medicago sativa L.): developmental patterns and response to applied nitrogen. Plant Physiol 67: 1198–1203 Herrera-Rodrı´ guez MB, Carrasco-Ballesteros S, Maldonado JM, Pineda M, Aguilar M, Pe´rez-Vicente R (2002) Three genes showing distinct regulatory patterns encode the asparagine synthetase of sunflower (Helianthus annuus). New Phytol 155: 33–45 Herrera-Rodrı´ guez MB, Maldonado JM, Pe´rez-Vicente R (2004) Light and metabolic regulation of HAS1, HAS1.1 and HAS2, three asparagine synthetase genes in Helianthus annuus. Plant Physiol Biochem 42: 511–518 Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database. Nucl Acids Res 27: 297–300 Hughes CA, Beard HS, Matthews BF (1997) Molecular cloning and expression of two cDNAs encoding asparagine synthetase in soybean. Plant Mol Biol 33: 301–311 Igbinnosa I, Thalouarn P (1996) Nitrogen assimilation enzyme activities in witchweed (Striga) in host presence or absence. Weed Sci 44: 224–232 Ireland RJ, Lea PJ (1999) The enzymes of glutamine, glutamate, asparagine, and aspartate metabolism. In: Singh BK (ed) Plant Amino Acids: Biochemistry and Biotechnology. Marcel Dekker, Inc., New York, pp 49–109 King GA, Woollard DC, Irving DE, Borst WM (1990) Physiological changes in Aspararagus spear after harvest. Physiol Plant 80: 393–400 Lam HM, Hsieh MH, Coruzzi G (1998) Reciprocal regulation of distinct asparagine synthetase genes by light and metabolites in Arabidopsis thaliana. Plant J 16: 345–353
Physiol. Plant. 123, 2005
Lam HM, Peng SSY, Coruzzi GM (1994) Metabolic regulation of the gene encoding glutamine-dependent asparagine synthetase in Arabidopsis thaliana. Plant Physiol 106: 1347–1357 Møller MG, Taylor C, Rasmussen SK, Holm PB (2003) Molecular cloning and characterization of two genes encoding asparagine synthetase in barley (Hordeum vulgare L.). Biochim Biophys Acta 1628: 123–132 Nakano K, Suzuki T, Hayakawa T, Yamaya T (2000) Organ and cellular localization of asparagine synthetase in rice plants. Plant Cell Physiol 41: 874–880 Ngai N, Tsai FY, Coruzzi G (1997) Light-induced transcriptional repression of the pea AS1 gene: identification of cis-elements and transfactors. Plant J 12: 1021–1034 Osuna D, Galvez-Valdivieso G, Piedras P, Pineda M, Aguilar M (2001) Cloning, characterization and mRNA expression analysis of PVAS1, a type I asparagine synthetase gene from Phaseolus vulgaris. Planta 213: 402–410 Pageau K, Simier P, Le Bizec B, Robins RJ, Fer A (2003) Characterization of nitrogen relationships between Sorghum bicolor and the root-hemiparasitic angiosperm Striga hermonthica (Del.) Benth. using K15N03 as isotopic tracer. J Exp Bot 54: 789–799 Press MC (1995) Carbon and nitrogen relations. In: Press MC, Graves JD (eds) Parasitic Plants. Chapman & Hall, London, pp 103–124 Quested HM, Press MC, Callaghan TV, Cornelissen JHC (2002) The hemiparasitic angiosperm Bartsia alpine has the potential to accelerate decomposition in sub-arctic communities. Oecologia 130: 88–95 Richards NG, Schuster SM (1998) Mechanistic issues in asparagine synthetase catalysis. Adv Enzymol Relat Areas Mol Biol 72: 145–198 Robert S, Dubreuil D, Simier P, Pradere JP, Fer A (1999) Inhibitions studies on mannose 6-phosphate reductase purified from Orobanche ramosa. Carbohydrate Lett 3: 231–238 Romagni JG, Dayan FE (2000) Measuring asparagine synthetase activity in crude plant extracts. J Agric Food Chem 48: 1692–1696 Rothnie HM (1996) Plant mRNA-30 -end formation. Plant Mol Biol 32: 43–61 Rousset A, Simier P, Fer A (2003) Characterization of simple in vitro cultures of Striga hermonthica suitable for metabolic studies. Plant Biol 5: 265–273 Sambrook F, Fritsch EF, Maniatis T (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring. Harbor Laboratory Press, Cold Spring Harbor, NY Shi L, Twary SN, Yoshioka H, Gregerson RG, Miller SS, Samac DA, Gantt JS, Unkefer PJ, Vance CP (1997) Nitrogen assimilation in alfalfa: isolation and characterization of an asparagine synthetase gene showing enhanced expression in root nodules and dark-adapted leaves. Plant Cell 9: 1339–1356 Strickland JDH, Parsons TR (1972) A practical handbook of seawater analysis. Fisheries Research Board of Canada, Ottawa Ta TC, Joy KW (1986) Separation of amino acid and amide nitrogen from plant extracts for 15N analysis. Anal Biochem 54: 564–569 Ta TC, MacDowal FDH, Faris MA (1989) Asparagine-synthetase from root nodules of alfafa. Biochem Cell Boil 67: 455–459 Terzaghi WB, Cashmore AR (1995) Light-regulated transcription. Annu Rev Plant Physiol Plant Mol Boil 46: 445–474 Thum KE, Shasha DE, Lejay LV, Coruzzi GM (2003) Light- and carbon-signaling pathways. Modeling circuits of interactions. Plant Physiol 132: 440–452 Tjaden G, Edwards JW, Coruzzi GM (1995) Cis element and transacting factors affecting regulation of a nonphotosynthetic lightregulated gene for chloroplast glutamine synthetase. Plant Physiol 108: 1109–1117 Toyofuku K, Umemura T, Yamaguchi J (1998) Promoter elements required for sugar-repression of the RAmy3D gene for alphaamylase in rice. FEBS Lett 428: 275–280 Tsai FY, Coruzzi G (1991) Light represses transcription of asparagine synthetase genes in photosynthetic and non photosynthetic organs of plants. Mol Cell Biol 11: 4966–4492 Vadez V, Sinclair TR, Sarraj R (2000) Asparagine and ureide accumulation in nodules and shoots as feedback inhibitors of N2 fixation in soybean. Physiol Plant 110: 215–233
19
Waterhouse RN, Smyth AJ, Massonneau A, Prosser IM, Clarkson DT (1996) Molecular cloning and characterization of asparagine synthetase from Lotus japonicus: dynamics of asparagine synthesis in N-sufficient conditions. Plant Mol Biol 30: 883–897 Wong HK, Chan HK, Coruzzi GM, Lam HM (2004) Correlation of ASN2 gene expression with ammonium metabolism in Arabidopsis. Plant Physiol 2004: 332–338
Yamagata H, Nakajima A, Bowler C, Iwasaki T (1998) Molecular cloning and characterization of a cDNA encoding asparagine synthetase from soybean (Glycine max L.) cell cultures. Biosci Biotechnol Biochem 62: 148–150 Yemm E, Cocking EC (1955) The determination of amino-acids with ninhydrin. Analyst 80: 209–213 Zalkin H, Smith JL (1998) Enzymes utilizing glutamine as an amide donor. Adv Enzymol Relat Areas Mol Biol 72: 87–144
Edited by J. K. Schjørring
20
Physiol. Plant. 123, 2005
