ARTICLE 2 Bischoff, E., Guillotte, M., Mercereau-Puijalon, O. and Bonnefoy, S.

A member of the Plasmodium falciparum Pf60 multigene family codes for a nuclear protein expressed by readthrough of an internal stop codon Molecular Microbiology, Vol. 35, p : 1-13, 2000

- 59 -

Molecular Microbiology (2000) 3 5 (5) : 1005-1016

A member of the P l a s m o d i u m f a l c i p a r u m Pf60 multigene family codes for a nuclear protein expressed by readthrough of an internal stop codon

1

Bischoff, E., Guillotte, M., Mercereau-Puijalon , O. and Bonnefoy, S. Unité d'Immunologie Moléculaire des Parasites, Institut Pasteur 25 rue du Dr Roux 757242Paris cedex 15 France Received 25 September, 199 ; revised 25 November, 1999 : accepted 29 November 1999

autonomously living organisms have highlighted the widespread occurrence of multigene families, which account for up to 50% of certain genomes (Brenner et al., 1995; Labedan and Riley, 1995; Tatusov et al., 1997). The diversification of individual genes within gene families provides a set of related molecules with a large array of recognition properties, specific functions or expression profiles, facilitating the fine tuning of biological activity according to specific cellular, developmental or environmental conditions (Henikoff et al., 1997; and references therein). Four large multigene families have been described in P. falciparum : the Pf60 (Carcy et al., 1994; Bonnefoy et al., 1997), var (Baruch et al., 1995; Smith et al., 1995; Su et al., 1995), rif (Weber, 1988; Gardner et al., 1998) and stevor (Limpaiboon et al., 1991; Cheng et al., 1998) families. Genome analysis has shown that most of the genes of these families are located in the telomeric or subtelomeric regions (Thompson et al., 1997; Gardner et al., 1998; Bowman et al., 1999). It has been suggested that the rif and stevor genes, which are structurally similar, are members of a larger superfamily. var and rif genes encode proteins present on the surface of P. falciparum-infected red blood cells and undergo antigenic variation. The var and rif genes are transcribed in young parasites and this process is tightly regulated (Scherf et al., 1998; Chen et al., 1998; Kyes et al., 1999). Conversely, Pf60 genes are expressed during the last hours of the P . f a l c i p a r u m intraerythrocytic cycle (Carcy et al., 1994).

Summary Four large multigene families have been described in P. falciparum malaria parasites ( var, rif, stevor and Pf60). Var and rif genes code for erythrocyte surface proteins and undergo clonal antigenic variation. We report here the characterisation of the first Pf60 gene. The 6.1 gene is constitutively expressed by all mature blood stages and codes for a protein located within the nucleus. It has a single copy, 7-exon, 5' domain, separated by an internal stop codon from a 3' domain which presents a high homology with var exon II. Double-site immunoassay and P. falciparum transient transfection using the reporter luciferase gene demonstrated translation through the internal ochre codon. The 6.1 N-terminal domain has no homology with any protein described to date. Sequence analysis identified a leucine zipper and a putative nuclear localisation signal, and showed a high probability for coiled coils. Evidence for N-terminal coiled coil-mediated protein interactions was obtained. This identifies 6.1 protein as a novel nuclear protein. These data show that the Pf60 and var genes form a superfamily with a common 3' domain, possibly involved in regulating homo or heteromeric interactions.

The P. falciparum Pf60 multigene family was identified using the Pf60.1 clone, which hybridised to an estimated number of 140 copies per genome and to abundant 3 kb mRNAs expressed by late stages (Carcy et al., 1994). The Pf60.1 clone was isolated from a P. falciparum genomic expression library using a serum that cross-reacted with a 60 kDa P. falciparum rhoptry antigen (Grellier et al., 1994). An antiserum raised to the Pf60.1 recombinant protein reacted with a 60 kDa antigen on P. falciparum merozoite immunoblots; it also reacted with a 60 kDa Babesia divergens merozoite protein. An homologue of a 60 kDa rhoptry antigen consensus motif encoded by the RAP-1 multigene family in several Babesia species (Suarez et al., 1991) was observed in the deduced Pf60.1 protein sequence. These data led us to conclude that the Pf60 gene family codes for

Introduction

Plasmodium falciparum parasites are responsible for 1-3 million deaths and 200-300 million clinical attacks of malaria each year. The present situation is alarming, with parasite resistance to multiple drugs spreading much more rapidly than novel antimalarials or vaccines are being developed. A major obstacle to the development of new control tools is our limited knowledge of basic parasite biology and the small number of potential intervention targets identified. Recent advances in the genomics of

1 corresponding author: [email protected]; tel (33) (0) 1 45 68 86 23; fax (33) (0) 40 61 31 85 2

K e y w o r d : multigene family / Plasmodium falciparum / stop codon readthrough / nucleus / coiled coil / leucine zipper

© 2000 Blackwell Science Ltd

- 61 -

B i s c h o f f e t al .

F i g u r e 2 7: O R F m a p f o r t h e 6 . 1 c D N A a n d a l i g n m e n t o f t h e 6 . 1 g e n e w i t h t h e v a r g e n e s . A: ORF map for the cDNA. The 2 reading frames are depicted as three rectangles, with stop codons indicated as bars the full height of the rectangle. ATG codons are shown as bars half the height of the rectangle.. B: 6.1 genomic structure compared with that of the var gene. Genes are aligned according to their 3’ region of homology, spanning cDNA 6.1 orf 2 and var exon II. A typical var gene (Dd2 var1 accession # L400608) is depicted. The genomic clone Pf60.1 is aligned with the other sequences. The orfs have been assigned specific symbols. Their predicted translation capacity is depicted. Introns are shown to scale.

(Genbank accession # U82509) was 2695 nucleotides long (Figure 27). The translation initiation codon was in position 145, with flanking sequences consistent with the initiation consensus of Sporozoa (Yamauchi, 1991). The cDNA contained 2 open reading frames separated by an in-phase ochre codon. Orf 1 was 807 nucleotides long. The second open reading frame started at position 952, was 1281 nucleotides long and, like most P. falciparum coding sequences, ended in an ochre codon. The sequence homologous to the Pf60.1 probe was located within orf 2 (Figure 27). The 3'-untranslated region had a high A+T content, typical of non-coding regions in P. falciparum. Immediately after the stop codon, there was a (TA)14 stretch , followed by 4 tandem copies of a specific 49 bp repeat, 2 of which were part of a 81 bp duplicated sequence.. An additional poly TA stretch was present further downstream. The unusual sequence ATTAAA (Hall et al., 1984; Mostov et al., 1984) was detected 24 bases upstream from the 3' poly-A tail, at the predicted position of the poly-adenylation signal (Birnstiel et al., 1985).

merozoite-associated antigens analogous to those encoded by the Babesia sp. RAP-1 family (Carcy et al., 1994). Subsequent cloning of the var genes revealed the presence of Pf60.1-related sequences within var genes and var-related transcripts (Su et al., 1995). There are approximately 50 var genes per genome, transcribed at the trophozoite stage into 7-9 kb mRNAs. Var genes have a large exon I which encodes the variable, surfaceexposed domain of PfEMP1 and a more conserved exon II, thought to be involved in interactions with the erythrocyte cytoskeleton (Chen et al., 1998; Deitsch and Wellems, 1996; Rowe et al., 1997). Additional 2kb var-related transcription products, consisting of unspliced intron and exon II sequences have been reported (Su et al., 1995). Both types of transcript contain a sequence within var exon II that is similar to that of the Pf60.1 clone. The aim of the work reported here was to investigate the organisation and expression constraints of the Pf60 genes (Carcy et al., 1994; Bonnefoy et al., 1997), to facilitate the rational design of novel intervention strategies targeting an essential common biological characteristic and/or expression mechanism specific to this family. We have screened a cDNA library constructed from mRNA isolated from late erythrocyte stages for Pf60 type genes. We report here the characterisation of the first Pf60 gene, encoded by an approximately 3 kb mRNA produced late in the schizogonic cycle. The expression profile and location of the protein were investigated and the relationship with var genes clarified.

Orf 1-derived cDNA sequences were used to probe P. falciparum 3D7 genomic DNA digested with a variety of restriction enzymes. This indicated that 6.1 was a single copy gene (data not shown). PCR was used to compare the genomic and cDNA organisation. The 6.1 gene contained 7 small introns, all located within orf 1 (Figure 27). Intron 4 was "in-frame" with its 5' exon. The introns were 70 to 189 nucleotides long. They were amplified using primers located within the neighbouring exons. The splice sites contained typical P. falciparum consensus splicing sequences (Vinkenoog et al., 1995) (data not shown). This structure suggested that the cDNA was a bona fide gene product. Direct sequencing of the genomic PCR product encompassing the orf 1 /orf 2 junction confirmed the presence of an internal ochre codon in the 3D7 gene sequence.

Results cDNA and gene structure

The 6.1 cDNA clone was isolated by screening a P. falciparum cDNA library constructed from late stage mRNAs isolated from cultures of the 3D7 parasite clone (Rawlings and Kaslow, 1992) with the 316 bp Pf60.1 insert (Carcy et al., 1994). The 6.1 cDNA

To rule out the possibility that the internal stop codon was 3D7specific, we generated a RT-PCR product from mRNA isolated from

© 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 62 -

A nucleus-associated Pf60/var P. famciparum protein

predicted protein sequence). Several putative phosphorylation signals were observed. ORF 1 contained 8 protein kinase C motifs and 4 casein kinase-2 motifs, whereas ORF2 contained 6 protein kinase C sites and 20 casein kinase-2 motifs. The deduced 6.1 ORF 1 protein sequence was also remarkable in that it had a strong prediction to form coiled-coils (Figure 28), consistent with the high frequency and regular spacing of leucine residues (accounting for 14 % of the amino acids of ORF 1 versus only 5 % for ORF2).

late-stage parasites of the unrelated FUP/CB strain. This product was sequenced directly and did indeed contain the internal ochre codon (data not shown). We are therefore confident that the 6.1 sequence expressed by P. falciparum parasites contains this internal ochre codon. RT-PCR analysis of RNA collected at various time points of the 48-hour cycle from synchronous FUP/CB cultures showed that, as expected, the 6.1 gene was transcribed at the schizont stage (data not shown). This indicates that the 6.1 product analysed here corresponds to one of the mRNAs of about 3 kb originally identified on Northern blots of synchronous cultures with the Pf60.1 probe (Carcy et al., 1994).

Identification of the gene product

To identify the product(s) of the 6.1 gene, specific antisera were raised against Schistosoma japonicum Glutathione S-transferase (GST) fusion proteins produced from cDNA-derived sequences. Two independent domains were expressed : the 92 – amino acid N-proximal domain of ORF 1 (hereafter called 161) and the Cterminal half of ORF 1, containing the leucine zipper and the putative NLS (hereafter called 261, see Figure 28). The antigenicity of the recombinant proteins was first checked with sera from subjects living in an area of Senegal in which P. falciparum is endemic. Specific profiles were obtained by ELISA, with 1 and/or 2 recombinant proteins recognised, depending on the serum studied, indicating that the recombinant antigens mimicked their parasite-expressed counterpart (data not shown).

PCR analysis of genomic DNA from 45 Senegalese isolates (Robert et al., 1996) using several sets of primers derived from the 5' unique region showed that the gene was present in all strains, with no evidence of polymorphism (data not shown). Homology with var genes

Searches of nucleotide and protein databases indicated that, in addition to the predicted region of similarity with Pf60.1, the 6.1 orf 2 aligned with var exon II over their entire length. For example, the deduced ORF 2 amino acid sequence was 73% identical to the 3D7 var7 intracellular domain. In some cases ( e. g. 3D7 var1), the region of similarity also extended into the 3'UTR. However, upstream from the 6.1 orf 1/orf 2 boundary and the var intron/exon II boundary, the sequence of 6.1 was unique and did not align with any region of P. falciparum var genes or with any other sequence from the databases (Figure 27). This indicates that the 6.1 gene and the var genes only share a common 3' domain.

The products of the 6.1 gene in the parasite were analysed, using immune sera raised against the recombinant proteins (161 or 261). Several individual antisera from CD1 outbred mice and New Zealand rabbits gave similar profiles on FUP/CB or 3D7 segmenter and merozoite immunoblots. A typical blot for a FUP/CB merozoite extract is shown in Figure 29A. None of the pre-immune sera reacted on immunoblots (lanes 2, 6 , 8). The control anti-GST mouse serum gave no signal (lane 1); a similar negative pattern was observed with a control anti-GST rabbit serum (not shown). In contrast, individual antisera directed against the 161- or the 261GST reacted with a 74 kDa merozoite antigen (lanes 3-5, 7 and

Searches for specific motifs identified several interesting features of the 6.1 protein (Figure 28). A leucine zipper was identified within ORF 1 (amino acid positions 214-235 of the predicted protein sequence), along with a putative nuclear localisation signal [NLS] (amino acid positions 245-252 of the

F i g u r e 2 8: C o i l e d - c o i l s t r u c t u r e p r e d i c t i o n a n d m o t i f s p r e s e n t i n t h e p r o t e i n 6 . 1 . This graph shows the probability of coiled-coil structure formation probability using the algorithm of Lupas (1991) for the 6.1 deduced amino acid sequence. The horizontal bars on top of the figure show the various frames for which coiled-coil structures were predicted. The grey upper bar indicates the position of the leucine zipper, the sequence of which is indicated in single letter code. The position of the putative NLS is indicated by an open square. Its sequence is indicated in single letter code. The position of the internal stop codon is indicated by an arrow (
); the protein kinase C phosphorylation sites by (
); casein kinase II phosphorylation sites by (); tyrosine kinase phosphorylation sites by (). The regions corresponding to the 161 and 261 recombinant proteins are shown below the graph. © 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 63 -

B i s c h o f f e t al .

Demonstration of readthrough by transient transfection

To confirm that there was translation through the internal ochre codon, we constructed artificial genes in which the luciferase gene was inserted into the 6.1 cDNA sequence. These artificial genes were used in transient transfection assays with FUP/CB parasite cultures. Transient transfection with the orf 1 / 2 plasmid construct, in which the reporter gene was inserted 57 nucleotides downstream from the internal ochre codon, resulted in expression of the luciferase gene (Figure 30). As predicted, the level of expression of this construct was lower than that for a construct in which the luciferase gene was inserted within orf 1 upstream from the 6.1 orf 1 / orf 2 junction (ORF1B). The translation efficiency (10%) for this gene was similar to that reported in other studies (Gesteland & Atkins, 1996; Tate et al., 1996). Insertion of the luciferase gene within orf 1, downstream from an artificial UAA stop codon totally abolished expression, indicating that readthrough depended on the local orf 1 /orf 2 junction context.

F i g u r e 2 9: I d e n t i f i c a t i o n o f t h e 6 . 1 g e n e p r o d u c t . A: Identification of the 6.1 gene product by immunoblot analysis of merozoite extracts. Lane 1: a control anti-GST mouse serum. Lane 2-7: individual anti-161 sera. Lane 2: anti-161 mouse #1 pre-immune serum (other pre-immune sera were also negative – not shown). Lanes 3, 4 and 5: anti-161 mouse # 1, 2 and 3 sera, respectively. Lane 6: anti-161 rabbit pre-immune serum. Lane 7: anti-161 rabbit serum. Lanes 8-9: rabbit anti-261 sera: lane 8: pre-immune serum, lane 9: immune serum. The individual sera were diluted 1/100 (mouse) and 1/5000 (rabbit). B: Identification of the 6.1 protein by double-site immunoassay. Proteins immunoprecipitated from an SDS extract of late schizonts by rabbit sera raised to GST recombinant antigens (lane 1: irrelevant GST fusion; lane 2: 261 GST; lane 3: C-terminal common domain (ATS) GST; lane 4: Pf60.1 GST) were separated by 7.5% SDS-PAGE and immunoblotted using a mouse anti-161 GST antiserum. Immune complexes were detected using an anti-mouse IgG alkaline phosphatase conjugate (Promega). The 74 kDa 6.1-specific protein is indicated with an arrow. Asterisks ( ) * indicate mouse Ig light and heavy chains.

Antigen location

The distribution of the antigen was investigated by indirect immunofluorescence and confocal microscopy. The anti-161 and anti-261 sera generated similar images, with a strong fluorescence signal co-localised with nuclear staining. The images obtained on segmenters (Figure 31, panels A and B for the anti161 and anti-261 antisera, respectively), indicated that 6.1 was a nuclear protein. Serial confocal images showed staining all over the nuclear mass, co-localised with the DNA. All schizonts stained with propidium iodide were labelled with the anti-161 and anti-261 sera, indicating expression of the 6.1 gene by all parasites. Both antisera also reacted with the nucleus of ring stages (panels C and D). None of the control sera raised against several irrelevant GST fusion proteins produced such images (data not shown).

9). None of the mouse or rabbit antisera directed against irrelevant GST-fusion proteins reacted with this antigen. An apparent molecular mass of 74 kDa is consistent with the predicted mass of 81 kDa for a protein produced by co-linear translation of both ORFs, the predicted mass of the ORF 1 product being 32 kDa. To demonstrate that the conserved C-terminal domain was present in the 74 kDa polypeptide recognised by the specific anti161 and -261 antisera, a double site immunoassay was performed. The antigen immunoprecipitated by a serum directed against the one domain was immunoblotted and probed with an antiserum directed against the other domain. As predicted, an anti-161 serum reacted on immunoblots with a 74 kDa antigen immunoprecipitated from an extract of segmenter stages by an anti-261 serum (Figure 29B, lane 2) and by an antiserum directed against the conserved C-terminal domain (lane 3). There was no reaction with antigens immunoprecipitated using antisera directed against irrelevant GST fusion proteins (an example is shown in lane 1; other negative controls not shown) or an antiserum directed against the Pf60.1 GST (lane 4). The failure of antibodies directed against Pf60.1 to immunoprecipitate or react with the 6.1 product probably reflects the sequence divergence of 6.1 and Pf60.1 (see Bonnefoy et al., 1997). The Pf60.1 region is also only 105 amino acids long, and is therefore less likely to elicit antibodies cross-reacting with a large number of family members than the common domain, which is about 500 residues long. An immunoassay with the reverse antiserum combination confirmed these results: the antiserum directed against the conserved Cterminal domain reacted on an immunoblot with the 74 kDa antigen immunoprecipitated by the anti-261 antiserum (data not shown). These results demonstrate that antibodies directed against the conserved C-terminal domain reacted with the polypeptide recognised by antibodies reacting with the unique Nterminal ORF 1 polypeptide. This indicates co-linear translation of both ORFs.

A coiled-coil domain involved in protein/protein

F i g u r e 3 0: A n a l y s i s o f t h e i n t e r n a l c D N A 6 . 1 s t o p c o d o n readthrough using a P . f a l c i p a r u m transient transfection assay . A: Schematic representation of the 6.1 cDNA, and of 3 constructs in which a 6.1 cDNA fragment was fused to the luciferase reporter gene. Arrows indicate the positions of the primers used for amplification. Internal TAA stop codons are shown by an Asterisks (*). B: Mean relative luciferase activity (with standard deviation) in parasites transformed using plasmid constructs containing truncated fragments of the 6.1 cDNA fused to the luciferase reporter gene.

© 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 64 -

A nucleus-associated Pf60/var P. famciparum protein

Discussion The data reported here show that one of the schizont-specific 3 kb Pf60 mRNAs, the product of the 6.1 gene, codes for a protein located in the nucleus. The 6.1 gene has a 3' domain in common with var genes. This indicates that the Pf60-type and var genes form a superfamily for which we suggest the name Pf60/var family. The var and the 6.1 Pf60 genes differ in their 5' structure, the cellular location of their gene products (erythrocyte membrane vs. nucleus) and intra-population diversity (diverse var exon I repertoire vs. absence of evidence for polymorphism of the 6.1 gene). They also differ in expression profile: regulated transcription in a fraction of trophozoites for the var genes, and constitutive transcription of the Pf60-type gene in all late stages. The Pf60-type cDNA analysed in this work was produced from an mRNA in which all 7 introns were spliced, but which contained an internal stop codon. This internal stop codon was found in 2 unrelated parasite strains, indicating that it was a real feature of this gene. Several lines of evidence suggested that translation readthrough occurs. Firstly, antisera raised in outbred animals against unique regions of the protein reacted with a 74 kDa antigen on immunoblots of 2 parasite lines. This antigen has approximately the predicted molecular mass of the ORF 1 + 2 product. The double-site immunoassay showed that an antiserum against the conserved C-terminal domain reacted with the same antigen as antisera against the N-terminal region. As the 5' domain is present as a single copy, there is little doubt that the single protein detected with several individual specific antisera was indeed the translation product of the 6.1 gene. Finally, the transient transfection assay unequivocally demonstrated expression of the luciferase reporter gene inserted within orf2, downstream from the internal stop codon. These data indicate that the 6.1 gene is expressed by readthrough of the internal stop codon in blood stage parasites.

F i g u r e 3 1: L o c a l i s a t i o n o f 6 . 1 p r o d u c t s b y c o n f o c a l microscopy. Panel A: Segmenters labelled with mouse anti-161 serum (Superimposition: left; FITC: middle; propidium iodide: right). Panel B: Segmenters labelled with mouse anti-261 serum (idem). Panel C: Ring stages labelled with mouse anti-161 serum (idem). Panel D: Ring labelled with mouse anti-261 serum (idem). The pre-immune sera and irrelevant anti-GST antisera did not react with nuclei (not shown) interactions

Coiled-coil domains are involved in protein-protein interactions. As a coiled-coil structure was predicted for 6.1, we investigated the ability of the recombinant 161 and 261 proteins to interact with other proteins in vitro. No interaction was detected between 261 and any of the proteins tested (data not shown). In contrast, 161 interacted in a dose-dependent manner with myosin in the presence of 0.1% Tween 20 or 0.1% Triton X-100, but did not interact with G-actin (Figure 32A and B). The presence of 0.1% SDS abolished this interaction (Figure 32C). A weaker interaction was observed with keratins, tubulin and laminin. 161 interacted most strongly with myosin, which has the longest coiled-coil tail of the proteins tested, consistent with the hypothesis of coiled-coil mediated interactions.

Translation through internal stop codons has long been known to occur particularly in bacteria and viruses (for a review see Gesteland & Atkins, 1996), but this is the first time that it has been observed in malaria parasites. In the context of an ongoing genome sequencing project, it is clear that caution is required in the interpretation of sequence data. We do not know the precise molecular mechanism underlying translation readthrough. Decoding of the internal ochre codon as selenocysteine is unlikely because selenocysteine is encoded by a UGA codon and because the specific 3' mRNA secondary structure (Böck et al., 1991) is absent from the 6.1 sequence. Suppression by an UAA-specific suppressor tRNA is also unlikely because the ochre codon is by far the most frequent termination codon in the P. falciparum genes sequenced to date. Whether a specific form of a particular elongation or release factor is involved in the 6.1 internal stop codon suppression as described in some systems (Hughes et al., 1987; Sandbaken and Culbertson, 1988) remains to be investigated. There is now substantial evidence that ribosomes can bypass leaky stop codons and that the sequence context of the internal stop codon affects this process. In the case of 6.1, the importance of the local context is suggested by the absence of readthrough for the ORF1A construct, in which the reporter gene was inserted in an atopic 5' situation downstream from an artificial UAA codon. Translation termination efficiency is strongly affected, in both prokaryotic and mammalian genes, by the identity of the base located immediately downstream from the stop codon (Tate

The formation of N-terminal coiled-coils was also suggested indirectly by the high titres of antibodies reacting with human keratin, an intermediate filament protein, in BALB/c mice immunised with the 161 (Figure 33). The titres of antibody directed against keratin were substantially higher than those for antibodies directed against the recombinant antigen itself. There was no keratin in the immunogen injected into the animals, as shown by the absence of a reaction with a monoclonal antibody directed against human keratin in immunoblots and ELISA and by silver staining of the 161 protein on polyacrylamide gels (data not shown). No reaction with keratin was observed using BALB/c antisera raised, in parallel, against the carrier GST (Figure 33), or against unrelated recombinant GST proteins (data not shown). Thus, the strong reaction with human keratin suggests the presence of heteroclitic antibodies reacting with coiled-coils (Figure 33). This conclusion is supported by the absence of a reaction of the antisera with other antigens frequently recognised by auto-antibodies induced during parasitic infections such as murine malaria (Ternynck et al., 1991). These antigens included tubulin, actin, myosin and, importantly, DNA (data not shown). The reaction with keratin was restricted to BALB/c sera. It was not observed in any of the outbred mice immunised with the 161 antigen, suggesting a specific bias in the immune repertoire of the BALB/c mouse.

© 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 65 -

B i s c h o f f e t al .

account for our inability to detect it. Stop suppression is usually less efficient than translation of canonical mRNAs and decreases the amount of protein produced. The low efficiency of translation of 6.1 was clear from the luciferase assay, in which translation of the reporter gene, which was located downstream from the internal ochre codon was about 10% that with a construct with no internal stop codon. This efficiency is similar to that for similar situations in other systems (Tate et al., 1996; Bjornsson et al., 1997). The non canonical translation of the 6.1 protein may reflect a specific requirement for fine tuning the amount of protein in the parasites, suggesting that interfering with 6.1 readthrough efficiency using specific drugs might have a negative effect on the parasite. Immunofluorescence studies with synchronous cultures showed that all parasitised cells produced the 6.1 protein. Consistent with the observed nuclear location of the protein, a putative nuclear localisation signal was identified in ORF 1. The presence of a leucine zipper motif suggests that the 6.1 protein may interact with DNA, as such motifs have been shown to be involved in dimerisation of numerous DNA binding proteins. Experiments are in progress to investigate a potential DNA binding propensity of the 261 protein. A direct role in regulating the expression of specific P. falciparum genes is unlikely, given the reaction of anti261 antibodies with the nuclei of other malaria species, such as P. berghei, and of cell lines such as HeLa, COS and Vero (data not shown). Structure predictions indicated a high probability of coiled-coils along the length of ORF 1. The tendency of the Nterminal domain of 6.1 to form coiled-coils is indicated by the induction of heteroclitic antibodies that strongly reacted with human keratins, a family of intermediate filament proteins (Albers and Fuchs, 1992). The dose-dependent binding of the recombinant protein, 161, to myosin and to a lesser degree to laminin, tubulin and keratin, also suggests coiled-coil mediated interactions. This raises the attractive hypothesis that the function of the 6.1 protein may be to connect the DNA with the nuclear cytoskeleton. A role for the 6.1 protein in nuclear organisation is consistent with its expression by all parasitised red blood cells and its presence in all strains. It is also consistent with the low level of translation, because over-expression might destabilise the nucleus.

F i g u r e 3 2: R e c o m b i n a n t 1 6 1 i n v i t r o b i n d i n g a s s a y . Binding of GST-161 to other proteins used to coat ELISA plates was tested in the presence of various detergents: 0.1% Tween 20 (A), 0.1% Triton X100 (B), 0.1% SDS (C). Symbols for the various proteins are as follows: keratins (
), laminin (), G-actin (), tubulin (), myosin (). The optical density indicated corresponds to the value obtained at 450nm minus that obtained at 650nm.

If the function of the N-terminal domain of 6.1 is to connect the nuclear cytoskeleton with the DNA, what is the function of the Cterminal conserved domain? The assembly of cytoskeletal components is usually controlled by the phosphorylation of regulatory domains. It is possible that the C-terminal domain acts as such a regulatory domain, as it contains numerous phosphorylation sites (Figure 28). This hypothesis is particularly interesting in the context of the stage-specific expression of the 6.1 protein and of its possible association with the nuclear cytoskeleton. We are currently studying the phosphorylation of the 6.1 protein to test whether the level of phosphorylation of the protein differs during and after mitosis. The conserved domain may regulate the protein/protein interactions of other members of the family. The PfEMP1 molecule is concentrated on the erythrocyte surface in specific protrusions called knobs, together with several other parasite proteins. Regulation of the interaction of PfEMP1 with other parasite proteins and/or erythrocyte proteins by phosphorylation of the C-terminal domain is therefore possible. Thus, interfering with the phosphorylation status of the C-terminal domain may affect numerous members of this family.

et al., 1996; McCaughan et al., 1995), and by the chemical nature of the amino acids encoded by the 2 codons preceding the stop codon (Bjornsson et al., 1996; Mottagui-Tabar et al., 1994). We are currently constructing mutants, in which those positions are changed, to address this point using the luciferase reporter gene assay. In addition, several studies show that the mRNA secondary structure is involved in recoding and readthrough processes (Gesteland & Atkins, 1996). Additional directed mutagenesis is required to investigate the influence of the mRNA secondary structure. Only a small proportion of genes have been shown to use recoding mechanisms (stop codon readthrough or frameshift) for the translation of their mRNA (for reviews see Gesteland & Atkins, 1996; Farabaugh, 1996). Translation involving readthrough of an internal stop codon frequently results in the production of a truncated polypeptide from a single mRNA due to the premature arrest of translation. We found no evidence of this in any of the immunoblots carried out with various parasite stages. Extreme instability and/or rapid degradation of the truncated product might © 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 66 -

A nucleus-associated Pf60/var P. famciparum protein

Isolation of Pf60 cDNA clones and DNA sequencing A P. falciparum 3D7 mature asexual and gametocyte stage cDNA library (Rawlings and Kaslow, 1992) was screened with the [α-32P]dATP nick-translated (Boehringer Mannheim) 316 bp Pf60.1 insert recovered from the λPf60.1 clone as previously described (Carcy et al., 1994). Plasmid DNA was prepared by alkaline lysis (Chen and Seeburg, 1985). Double-stranded DNA was sequenced using the Sequenase kit (USB). T7 and Sp6 oligonucleotide sequencing primers were initially used, and specific oligonucleotides (GENSET) thereafter. Direct genomic sequencing P. falciparum 3D7 genomic DNA was prepared as previously described (Bonnefoy et al., 1992) and specific sequences were amplified by PCR using cDNA-specific synthetic oligonucleotides, in a Gene-cycler (Bio-Rad) using Taq DNA polymerase (Promega) in the reaction buffer provided by the manufacturer. PCR products were then ligated into pCRII (Invitrogen). A second amplification was performed with the ligation product, using one sequence-specific primer and the M13 reverse primer. PCR products were gel-purified and sequenced with the M13 reverse primer using the Cycle Sequencing Kit (Perkin Elmer) according to the manufacturer's instructions.

F i g u r e 3 3: E L I S A a n a l y s i s o f t h e r e a c t i o n o f a n t i - 1 6 1 G S T BALB/c sera with various antigens. Reactivity of an individual anti-161 GST BALB/c serum with GST (), recombinant protein 161 (), keratins (). Antibodies directed against the carrier GST were absorbed onto a GST-affinity column as described in Materials and Methods. The pre-immune sera did not react (not shown). The optical density indicated corresponds to the value obtained at 450nm minus that obtained at 650nm.

Plasmid constructs All final constructs were based on pHLH1 (Wu et al., 1995), in which the luciferase coding sequence is fused between the 5’ flanking region of the hrp3 gene, providing the promoter sequence, and the hrp2 3’ regulatory sequence. The various 6.1 gene fragments were amplified by PCR from the 6.1 cDNA using specific oligonucleotides containing artificial NsiI restriction sites. The 5’ primer for all constructs was 5’GAAATGCATAATCCCCCTTTT. The 3’ primers were 5’-ATCATGCATCTAATTCCTTTTCCT (6.1 ORF 1A), 5’-ATCATGCATAGATATATCTAAATC (6.1 ORF 1B), 5’ATAATGCATTTTGGGGATATTAAT (6.1 ORF 1/2). The amplified fragments were inserted into pCR2.1 (Invitrogen), then excised with NsiI and inserted into NsiI-digested pHLH1. The resulting constructs contained the luciferase fused downstream from the 6.1 coding sequences. Each construct was checked by restriction analysis for proper orientation, and was sequenced before use.

The picture that emerges from this work is that of a Pf60/var superfamily of individual genes with a common 3' domain. It has been estimated that there are 140 copies of Pf60.1 homologues per haploid genome (Carcy et al., 1994). About of 50 of these copies correspond to var exon II. The published sequences of chromosomes 2 and 3 indicate that some of the so-called varC fragments are pseudogenes (Gardner et al., 1998; Bowman et al., 1999). The actual number of Pf60-type genes within the genome is unclear. In addition to the nuclear-associated 6.1 protein, the Pf60-type genes include a parasite plasma membrane-associated antigen (manuscript in preparation), and probably the as yet uncloned gene coding for the 60 kDa rhoptry antigen, which reacts with the antiserum used to isolate the original Pf60.1 clone. It is likely that other genes exist, as ten different Pf60-type cDNAs were isolated by hybridisation with the Pf60.1 probe (Carcy et al., 1994), eight of which remain to be analysed. Thus, it appears that var genes consist of 2 cassettes: a DBL-domain-encoding cassette (exon 1) and a conserved domain-encoding cassette (exon 2). Both cassettes have paralogues in merozoite-associated proteins: the 6.1 protein for exon II and eba/ebl for exon I. Another example of mosaic genes has recently been described with the maebl gene in P. yoelii (Kappe et al., 1998). The complex relationships within the large Pf60/var family are a striking illustration of mosaicism in proteins, an increasingly recognised phenomenon in many organisms (Henikoff et al., 1997).

Luciferase assay Infected erythrocytes were recovered from culture and washed once with 5 volumes of ice-cold PBS. Free parasites were obtained by saponin lysis for 3 min at RT in 2 volumes of 0.15% saponin and were washed twice in ice-cold PBS. They were resuspended in 50 µl 1x luciferase lysis buffer (Promega) supplemented with protease inhibitors (1 µg/ml Aprotinin, 20 µg/ml Bestatin, 0.1 mg/ml Peflabloc, 0.5 µg/ml Leupeptin, 350 ng/ml Pepstatin; Boehringer). Resuspended parasites were lysed using 3 cycles of freezing in dry ice and thawing at 37°C. The suspension was centrifuged and 5 µl of supernatant was tested for luciferase activity using a luciferase assay kit (Promega). Photon counts were normalised according to parasitaemia. Recombinant protein purification The 5'-proximal (161, amino acids 1-90) and 3'-proximal (261, amino acids 91-266) domains of the 6.1 orf 1 cDNA were amplified using specific internal primers. The forward primers contained an in-phase 5' BamHI restriction site and the reverse primers contained a 3' HindIII site in-frame with the vector stop codon located immediately downstream. The sequences of the primers were as follows: 161.5: 5’AATGGATCCAATGGTTAATCCCCC-3'; 161.3: 5’-TTTAAGCTTTCAATTCCTCATTC-3'; 261.5: 5’-TGAGGATCCAAATAGAAGAGTTAATAAG-3’; 261.3: 5’TTTAAGCTTATATTTTATAAGATATTTTATTATTAC-3’). The PCR products were purified, digested and subcloned into the BamHI/HindIII-digested pGEX-A vector. The recombinant polypeptides (respectively named 161 and 261) were purified by affinity chromatography on glutathione-agarose beads (Sigma) as described elsewhere (Smith and Johnson, 1988).

Experimental Procedures P. falciparum culture and transfection P. falciparum FUP/CB strain [FCR3 genotype] (Fandeur et al., 1991) and the 3D7 clone (Walliker et al., 1987) were cultured with leukocyte-free human erythrocytes at 5% haematocrit in RPMI 1640 medium, supplemented with 10% human serum, and grown in tissue culture flasks in a 5% CO2 / 95% air atmosphere at 37°C. For some experiments, we used RPMI 1640 (Gibco BRL), 0.5 % albumax 1 (Gibco BRL, low IgG BSA culture grade). Knob-positive parasites were selected weekly by gelatin flotation. Purified merozoites were obtained from mature schizont-enriched preparations as described elsewhere (Roggwiller et al., 1997). Parasites were treated with 5% sorbitol before electroporation. Each transfection was performed in a 2 mm cuvette with 109 ring stage-infected erythrocytes (10% parasitaemia) in a final volume of 400 µl cytomix with 100 µg plasmid construct. Electroporation was performed using a BIORAD electroporator set at 0.31 kV, 950 µFa. Electroporated parasites were immediately mixed with 10 ml culture medium and adjusted to 5% haematocrit. Culture medium was replaced daily and parasites were harvested 72 hours after electroporation.

Immunisations. Eight-week-old female outbred mice (CD1 strain, Charles River) were immunised with 20 µg of recombinant 161, 261 or carrier protein in Freund’s complete adjuvant for the first immunisation. Subsequent immunisations were performed in Freund’s incomplete adjuvant at 4 to-5 week intervals. Bleedings were done 8 days after each injection. Male rabbits were immunised with 200 µg of recombinant protein using the same protocol. Immunoblot analysis. Merozoites were resuspended in boiling electrophoresis SDS sample buffer, heated for 5 min at 100°C and centrifuged for 30 min at 4°C. The proteins were separated by electrophoresis in a 10 % SDS polyacrylamide gel and transferred onto nitrocellulose. Membranes were saturated by incubation for 1 hr at RT with 5% nonfat powdered milk, incubated for 1 hr with the appropriate dilution of specific antisera in PBS, 0.1% Tween-20 and then with anti-species alkaline phosphatase-conjugated

© 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 67 -

B i s c h o f f e t al .

4.

IgG (Promega Biotec) under the same conditions. The detection procedure was as recommended by the manufacturer. Double-site immunoassay Palo Alto FUP/CB parasites were fractionated on plasmagel and allowed to mature to the segmenter stage in RPMI containing 10% serum. The SDS extract was prepared by resuspending the parasites with 1 vol. PBS, 2% SDS, 1% Triton X-100, leupeptin and pepstatin at 20 µg/ml each. The extract was incubated for 15 min at 4°C, then centrifuged at 12,000g at 4°C for 30 min. The supernatant was recovered and stored at -80°C until use. For each assay, a 20 µl aliquot of extract was diluted 1/20 in PBS, 0.5% Triton X-100, 20 µg/ml protease inhibitors and incubated overnight at 4°C in the presence of 20µl of serum and 420 µl of buffer A (10 mM Tris-HCl pH 7.4, 10 mM EDTA, 400 mM NaCl), 1% Triton X-100, 20 µg/ml each of leupeptin and pepstatin. The extract was then incubated for 2 hrs on ice with 100µl of 10% protein A-sepharose beads (diluted in buffer A, 1% Triton, 1 mg/ml ovalbumin). The beads were collected by centrifugation for 3 min., 12000 g at 4°C and washed 3 times in buffer A, 1% TritonX-100, 1mg/ml ovalbumin, twice in buffer A, 1% Triton X-100 and twice in buffer A. The immunoprecipitates were then analysed by immunoblotting as described above, except that the ECL detection system (Amersham) was used.

5.

6.

7.

8.

Indirect immunofluorescence assay. Air-dried fixed mature P. falciparum intra-erythrocyte stages from albumaxsupplemented culture were incubated with sera diluted 1/50. Specific antibodies were detected with fluorescein (DTAF)-conjugated goat anti-mouse immunoglobulins adsorbed on human red blood cells. Parasite nuclei were stained with 10 µg/ml propidium iodide. Slides were analysed by confocal microscopy using an Axiovert 100M microscope (Zeiss).

9. 10.

ELISA Microtitre plates (96 wells, CML) were coated with 100 µl of 1 µg/ml antigen in PBS, pH 7.4. They were incubated overnight at 4°C, and the plates were saturated by incubation for 1 hr at 37°C with PBS containing 5% low-fat milk powder, 0.05% Tween-20 and incubated for 1 hour at 37°C with 100 µl of diluted serum in PBS containing 5% low-fat milk powder, 0.05% Tween-20. The plates were extensively washed and 100 µl of a 1/10,000 dilution of peroxidase-conjugate anti-mouse IgG (Promega) was added. The plates were incubated 1 hour at 37°C and extensively washed. Binding was detected using 100 µl TMB substrate (KPL). Reactions were allowed to proceed for 10 min at RT and stopped by adding 100µl 1M H3PO4. Data were acquired in a Titertek Multiscan (Flow Laboratories) and analysis was done using the Softmax program. All tests were performed in duplicate.

11. 12.

13.

14. In vitro binding assay Microtitre plates were coated with rabbit muscle myosin (Sigma, M1636), keratin from human epidermis (Sigma, K0253), tubulin from bovine brain (Sigma, T4925), rabbit muscle G-actin (Sigma, A2522), or laminin from human placenta (Sigma, A6274) under conditions used for ELISA. Plates were saturated as for ELISA and incubated for 1 hour at 37°C with 100 µl of diluted recombinant 161 protein in PBS, 5% low-fat milk powder, 0.1% detergent (Tween 20, Triton X-100 or SDS). The plates were extensively washed in PBS, 0.1% detergent, then incubated with 1/200-diluted mouse anti-GST serum in PBS, 0.1% detergent, washed, and binding was revealed as for ELISA.

15.

16. 17.

Acknowledgements

18.

We thank Dr. David Kaslow for generously supplying the 3D7 cDNA library and Victor Fernandez for providing an anti-ATS (C-terminal domain) antiserum. We are grateful to Thierry Blisnick for his help in merozoite preparation and to Raymond Hellio for his help in the confocal analysis. The confocal microscope of the Institut Pasteur was purchased with a donation from Marcel and Liliane Pollack. We would like to thank Eduardo Cesar Santos Lima and Peter David for helpful discussion. Emmanuel Bischoff received a fellowship from The Caisse Nationale d'Assurance Maladie. This work was supported by a grant from the Ministère de l'Education Nationale, de la Recherche et de la Technologie, France (Programme de Recherches de Microbiologie).

19.

20.

21. References

1. 2.

3.

Albers, K., and Fuchs, E. (1992) The molecular biology of intermediate filament proteins. Int Rev Cytol 1 3 4 : 243-279. Baruch, D.I., Pasloske, B.L., Singh, H.B., Bi, X., Ma, X.C., Feldman, M., Taraschi, T.F., and Howard, R.J. (1995) Cloning the P . falciparum gene encoding PfEMP1, a malarial antigen and adherence receptor on the surface of parasitized human erythrocytes. Cell 8 2 : 78-87. Birnstiel, M.L., Busslinger, M., and Strub, K. (1985) Transcription termination and 3' processing: the end is in site. Cell 4 1 : 349-359.

22.

23.

24.

© 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 68 -

Bjornsson, A., Mottagui-Tabar, S., and Isaksson, L.A. (1996) Structure of the C-terminal end of the nascent peptide influences translation termination. Embo J 1 5 : 1696-1704. Böck, A., Forchhammer, K., Heider, J., and Baron, C. (1991) Selenoprotein synthesis: an expansion of the genetic code. Trends Biochem Sci 1 6 : 463-467. Bonnefoy, S., Bischoff, E., Guillotte, M., and Mercereau-Puijalon, O. (1997) Evidence for distinct prototype sequences within the Plasmodium falciparum Pf60 multigene family. Mol Biochem Parasitol 8 7 : 1-11. Bonnefoy, S., Guillotte, M., Langsley, G., and Mercereau-Puijalon, O. (1992) Plasmodium falciparum: characterization of gene R45 encoding a trophozoite antigen containing a central block of six amino acid repeats. Exp Parasitol 7 4 : 441-451. Bowman, S., Lawson, D., Basham, D., Brown, D., Chillingworth, T., Churcher, C.M., Craig, A., Davies, R.M., Devlin, K., Feltwell, T., Gentles, S., Gwilliam, R., Hamlin, N., Harris, D., Holroyd, S., Hornsby, T., Horrocks, P., Jagels, K., Jassal, B., Kyes, S., McLean, J., Moule, S., Mungall, K., Murphy, L., Barrell, B.G., et al (1999) The complete nucleotide sequence of chromosome 3 of Plasmodium falciparum. Nature 4 0 0 : 532-538. Brenner, S.E., Hubbard, T., Murzin, A., and Chothia, C. (1995) Gene duplications in H. influenzae. Nature 3 7 8 : 140. Carcy, B., Bonnefoy, S., Guillotte, M., Le Scanf, C., Grellier, P., Schrevel, J., Fandeur, T., and Mercereau-Puijalon, O. (1994) A large multigene family expressed during the erythrocytic schizogony of Plasmodium falciparum. Mol Biochem Parasitol 6 8 : 221-233. Chen, E., and Seeburg, P. (1985) Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4 : 165-170. Chen, Q., Fernandez, V., Sundstrom, A., Schlichtherle, M., Datta, S., Hagblom, P. and Wahlgren, M. (1998) Developmental selection of var gene expression in Plasmodium falciparum. Nature 3 9 4 : 392395. Cheng, Q., Cloonan, N., Fisher, K., Thomson, J., Waine, G., Lanzer, M. and Saul, A. (1998) stevor and rif are Plasmodium falciparum multicopy gene families which potentially encode variant antigens. Mol Biochem Parasitol 9 7 : 161-176. Deitsch, K.W., and Wellems, T.E. (1996) Membrane modifications in erythrocytes parasitized by Plasmodium falciparum. Mol Biochem Parasitol 7 6 : 1-10. Fandeur, T., Bonnefoy, S., and Mercereau-Puijalon, O. (1991) In vivo and in vitro derived Palo Alto lines of Plasmodium falciparum are genetically unrelated. Mol Biochem Parasitol 4 7 : 167-178. Farabaugh, P.J. (1996) Programmed translational frameshifting. Microbiol Rev 6 0 : 103-134. Gardner, M.J., Tettelin, H., Carucci, D.J., Cummings, L.M., Aravind, L., Koonin, E.V., Shallom, S., Mason, T., Yu, K. and Fujii, C. (1998) Chromosome 2 sequence of the human malaria parasite Plasmodium falciparum.Science 2 8 2 : 1126-1132. Gesteland, R.F., and Atkins, J.F. (1996) Recoding: dynamic reprogramming of translation. Annu Rev Biochem 6 5: 741-768. Grellier, P., Precigout, E., Valentin, A., Carcy, B., and Schrevel, J. (1994) Characterization of a new 60 kDa apical protein of Plasmodium. Biol Cell 8 2 : 129-138. Hall, R., Hyde, J.E., Goman, M., Simmons, D.L., Hope, I.A., Mackay, M., and Scaife, J. (1984) Major surface antigen of a human malaria parasite cloned and expressed in bacteria. Nature 3 1 1 : 379-385. Henikoff, S., Greene, E.A., Pietrokovski, S., Bork, P., Attwood, T. K., and Hood, L. (1997) Gene families: the taxonomy of protein paralogs and chimeras. Science 2 7 8 : 609-614. Hughes, D., Atkins, J.F., and Thompson, S. (1987) Mutants of elongation factor Tu promote ribosomal frameshifting and nonsense readthrough. Embo J 6 : 4235-4239. Kappe, S.H.I., Noe, A.R., Fraser, T.S., Blair, P.L., and Adams, J.H. (1998) A family of chimeric erythrocyte binding proteins of malaria parasites. Proc Natl Acad Sci USA 9 5 : 1230-1235. Kyes, S.A., Rowe, J.A., Kriek, N. and Newbold, C.I. (1999) Rifins: a second family of clonally variant proteins expressed on the surface of red cells infected with Plasmodium falciparum. Proc Natl Acad Sci USA 9 6 : 9333-9338.

A nucleus-associated Pf60/var P. famciparum protein

25.

26.

27. 28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42. 43.

Labedan, B., and Riley, M. (1995) Gene products of Escherichia coli: sequence comparisons and common ancestries. Mol Biol Evol 1 2 : 980-987. Limpaiboon, T., Shirley, M.W., Kemp, D.J. and Saul, A. (1991) 7H8/6, a multicopy DNA probe for distinguishing isolates of Plasmodium falciparum. Mol Biochem Parasitol 4 7 : 197-206. Lupas, A., Van Dyke, M., and Stock, J. (1991) Predicting coiled coils from protein sequences. Science 2 5 2 : 1162-1164. McCaughan, K.K., Brown, C.M., Dalphin, M.E., Berry, M.J., and Tate, W.P. (1995). Translational termination efficiency in mammals is influenced by the base following the stop codon. Proc Natl Acad Sci USA 9 2 : 5431-5435. Mostov, K.E., Friedlander, M., and Blobel, G. (1984) The receptor for transepithelial transport of IgA and IgM contains multiple immunoglobulin-like domains. Nature 3 0 8 : 37-43. Mottagui-Tabar, S., Bjornsson, A., and Isaksson, L. A. (1994) The second to last amino acid in the nascent peptide as a codon context determinant. EMBO J 1 3 : 249-257. Rawlings, D.J., and Kaslow, D.C. (1992) A novel 40-kDa membraneassociated EF-hand calcium-binding protein in Plasmodium falciparum. J Biol Chem 2 6 7 : 3976-3982. Robert, F., Ntoumi, F., Angel, G., Candoto, D., Rogier, C., Fandeur, T., Sarthou, J.-L., and Mercereau-Puijalon, O. (1996) Extensive genetic diversity of Plasmodium falciparum isolates collected from patients with severe malaria in Dakar, Senegal. Trans Roy Soc Trop Med Hyg 9 0 : 704-711. Roggwiller, E., Fricaud, A.C., Blisnick, T., and Braun-Breton, C. (1997) Host urokinase-type plasminogen activator participates in the release of malaria merozoites from infected erythrocytes. Mol Biochem Parasitol 8 6 : 49-59. Rowe, J.A., Moulds, J.M., Newbold, C.I., and Miller, L.H. (1997) P. falciparum rosetting mediated by a parasite-variant erythrocyte membrane protein and complement-receptor 1. Nature 3 8 8: 292295. Sandbaken, M.G., and Culbertson, M.R. (1988) Mutations in elongation factor EF-1 alpha affect the frequency of frameshifting and amino acid misincorporation in Saccharomyces cerevisiae. Genetics 1 2 0 : 923-934. Scherf, A., Hernandez-Rivas, R., Buffet, P., Bottius, E., Benatar, C., Pouvelle, B., Gysin, J. and Lanzer, M. (1998) Antigenic variation in malaria: in situ switching, relaxed and mutually exclusive transcription of var genes during intra-erythrocytic development in Plasmodium falciparum. EMBO J 1 7 : 5418-5426. Smith, D., and Johnson, K. (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusion proteins with Glutathione S-transferase. Gene 2 9 : 31-40. Smith, J.D., Chitnis, C.E., Craig, A.G., Roberts, D.J., Hudson-Taylor, D.E., Peterson, D.S., Pinches, R., Newbold, C.I., and Miller, L.H. (1995) Switches in expression of Plasmodium falciparum var genes correlate with changes in antigenic and cytoadherent phenotypes of infected erythrocytes. Cell 8 2 : 101-110. Su, X., Heatwole, V.M., Wertheimer, S.P., Guinet, F., Herrfeldt, J.A., Peterson, D.S., and Ravetch, J.A. (1995) The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of Plasmodium falciparum-infected erythrocytes. Cell 8 2 : 89-100. Suarez, C.E., McElwain, T.F., Stephens, E.B., Mishra, V.S., and Palmer, G.H. (1991) Sequence conservation among merozoite apical complex proteins of Babesia bovis, Babesia bigemina and other Apicomplexa. Mol Biochem Parasitol 4 9 : 329-332. Tate, W.P., Poole, E.S., Dalphin, M.E., Major, L.L., Crawford, D.J, and Mannering SA. (1996) The translational stop signal: codon with a context, or extended factor recognition element? Biochimie 7 8 : 945-952. Tatusov, R.L., Koonin, E.V., and Lipman, D.J. (1997) A genomic perspective on protein families. Science 2 7 8 : 631-637. Ternynck, T., Falanga, P.B., Unterkirscher, C., Gregoire, J., da Silva, L.P., and Avrameas, S. (1991) Induction of high levels of IgG autoantibodies in mice infected with Plasmodium chabaudi. I n t Immunol 3 : 29-37.

44.

45.

46.

47. 48.

49.

Thompson, J.K., Rubio, J.P., Caruana, S., Brockman, A., Wickham, M.E. and Cowman, A.F. (1997) The chromosomal organization of the Plasmodium falciparum var gene family is conserved. Mol Biochem Parasitol 8 7 : 49-60. Vinkenoog, R., Veldhuisen, B., Speranca, M.A., del Portillo, H.A., Janse, C., and Waters, A.P. (1995) Comparison of introns in a cdc2homologous gene within a number of Plasmodium species. Mol Biochem Parasitol 7 1 : 233-241. Walliker, D., Quakyi, I.A, Wellems, T.E., McCutchan, T.F., Szarfman, A., London, W.T., Corcoran, L.M., Burkot T.R., and Carter R. (1987) Genetic analysis of the human malaria parasite Plasmodium falciparum. Science 2 3 6 : 1661-1666. Weber, J.L. (1988) Interspersed repetitive DNA from Plasmodium falciparum. Mol Biochem Parasitol 2 9 : 117-124. Wu, Y., Sifri, C.D., Lei, H.H., Su, X.Z., and Wellems, T.E. (1995) Transfection of Plasmodium falciparum within human red blood cells. Proc Natl Acad Sci USA 9 2 : 973-977. Yamauchi, K. (1991) The sequence flanking translational initiation site in protozoa. Nucleic Acids Res 1 9 : 2715-2720.

© 2000 Blackwell Science Ltd, Molecular Microbiology, 3 5 : 1005-1016

- 69 -